Incidental Mutation 'R0446:Olfr1153'
ID39351
Institutional Source Beutler Lab
Gene Symbol Olfr1153
Ensembl Gene ENSMUSG00000048197
Gene Nameolfactory receptor 1153
SynonymsGA_x6K02T2Q125-49395950-49396882, MOR177-7
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87894962-87898310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87896855 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 219 (Y219H)
Ref Sequence ENSEMBL: ENSMUSP00000150945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052300] [ENSMUST00000215017] [ENSMUST00000215862] [ENSMUST00000217436]
Predicted Effect probably benign
Transcript: ENSMUST00000052300
AA Change: Y227H

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057839
Gene: ENSMUSG00000048197
AA Change: Y227H

DomainStartEndE-ValueType
Pfam:7tm_4 38 315 4.9e-45 PFAM
Pfam:7tm_1 48 297 5.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215017
Predicted Effect probably benign
Transcript: ENSMUST00000215862
Predicted Effect possibly damaging
Transcript: ENSMUST00000217436
AA Change: Y219H

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Olfr1153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Olfr1153 APN 2 87896921 missense probably benign 0.00
IGL02024:Olfr1153 APN 2 87896899 missense possibly damaging 0.81
IGL02219:Olfr1153 APN 2 87896973 missense possibly damaging 0.93
IGL02693:Olfr1153 APN 2 87896533 missense probably damaging 1.00
R0121:Olfr1153 UTSW 2 87897090 missense possibly damaging 0.93
R0315:Olfr1153 UTSW 2 87897066 missense probably damaging 1.00
R0472:Olfr1153 UTSW 2 87896493 missense possibly damaging 0.47
R0720:Olfr1153 UTSW 2 87896669 missense probably benign 0.31
R1579:Olfr1153 UTSW 2 87896942 missense probably benign 0.05
R1968:Olfr1153 UTSW 2 87897039 missense probably damaging 1.00
R3909:Olfr1153 UTSW 2 87896949 unclassified probably null
R4936:Olfr1153 UTSW 2 87896813 missense probably benign 0.06
R5520:Olfr1153 UTSW 2 87896409 unclassified probably benign
R5585:Olfr1153 UTSW 2 87896675 missense possibly damaging 0.54
R6176:Olfr1153 UTSW 2 87896936 missense probably benign 0.18
R6272:Olfr1153 UTSW 2 87896657 missense probably benign 0.00
R6451:Olfr1153 UTSW 2 87896591 missense probably damaging 1.00
R7312:Olfr1153 UTSW 2 87896411 missense possibly damaging 0.54
R7350:Olfr1153 UTSW 2 87896409 unclassified probably benign
Z1088:Olfr1153 UTSW 2 87896633 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCAACCCCTTGATGTATGCGGTAG -3'
(R):5'- ATCCAGGGAATAAGCAGAACTTGGC -3'

Sequencing Primer
(F):5'- GGTAGATGCTTTGACACATACAACG -3'
(R):5'- CCGGAAATACATGAAGAGCATTG -3'
Posted On2013-05-23