Mutagenetix > Incidental Mutation

Incidental Mutation 'R5125:Dhx29'

393516

Institutional Source

Beutler Lab

Gene Symbol

Dhx29

Ensembl Gene

ENSMUSG00000042426

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 29

Synonyms

E130202M19Rik

MMRRC Submission

042713-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5125 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112927454-112969432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 112932600 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 155 (S155A)

Ref Sequence

ENSEMBL: ENSMUSP00000153182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038574] [ENSMUST00000224176]

AlphaFold

Q6PGC1

Predicted Effect

probably benign
Transcript: ENSMUST00000038574
AA Change: S155A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: S155A

Domain	Start	End	E-Value	Type
low complexity region	10	36	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	209	225	N/A	INTRINSIC
low complexity region	240	255	N/A	INTRINSIC
coiled coil region	279	308	N/A	INTRINSIC
low complexity region	343	358	N/A	INTRINSIC
Blast:DEXDc	411	450	2e-14	BLAST
DEXDc	569	763	1.09e-27	SMART
low complexity region	846	856	N/A	INTRINSIC
HELICc	880	985	6.1e-17	SMART
HA2	1047	1138	8.9e-26	SMART
Pfam:OB_NTP_bind	1178	1298	3.8e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223866

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224176
AA Change: S155A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225929

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226022

Meta Mutation Damage Score

0.0602

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abt1	G	T	13: 23,422,649	A94E	possibly damaging	Het
Carmil2	G	T	8: 105,696,889	G1207V	probably damaging	Het
Cyp2c66	A	G	19: 39,171,029	Y308C	probably damaging	Het
Dcc	A	G	18: 71,456,877	F683L	probably benign	Het
Denr	A	T	5: 123,927,081	I166F	probably damaging	Het
Dsg1b	G	A	18: 20,397,503	G405E	probably damaging	Het
Ei24	T	A	9: 36,782,446		probably benign	Het
Exo5	A	T	4: 120,921,537		probably null	Het
Gm15922	T	A	7: 3,739,397	K44*	probably null	Het
Gm7356	T	C	17: 14,001,314	D151G	probably damaging	Het
Grin1	T	C	2: 25,296,827		probably benign	Het
Grin2b	C	T	6: 135,923,299	V195M	possibly damaging	Het
Hephl1	T	A	9: 15,086,172	K399N	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kmt2c	A	G	5: 25,284,381	V4520A	probably damaging	Het
Lair1	G	A	7: 4,010,489	T82I	possibly damaging	Het
Lmx1a	C	T	1: 167,830,687	S213L	possibly damaging	Het
Ly6g6d	A	G	17: 35,074,442	I8T	possibly damaging	Het
Mcm4	T	A	16: 15,635,303	D174V	probably benign	Het
Mcph1	T	A	8: 18,607,326	D60E	probably damaging	Het
Med12l	G	A	3: 59,267,214	G1851D	possibly damaging	Het
Olfr156	T	A	4: 43,820,480	I294F	probably benign	Het
Olfr868	T	A	9: 20,101,192	C144*	probably null	Het
P2rx2	G	A	5: 110,342,651	T66I	possibly damaging	Het
Pcdh15	A	G	10: 74,584,080	E1197G	probably damaging	Het
Ppwd1	A	T	13: 104,220,435	S191T	probably benign	Het
Rbm39	A	T	2: 156,162,865	M184K	probably damaging	Het
Reln	A	G	5: 21,913,241	V2935A	possibly damaging	Het
Robo4	T	C	9: 37,407,960	W535R	probably damaging	Het
Rsf1	A	G	7: 97,661,872	D603G	possibly damaging	Het
Sh3rf3	C	G	10: 59,131,190	P785A	probably benign	Het
Slc22a26	T	C	19: 7,790,175	T289A	possibly damaging	Het
Slc24a3	T	C	2: 145,518,847	V120A	possibly damaging	Het
Sost	C	T	11: 101,963,941	G181R	probably damaging	Het
Sp2	A	G	11: 96,955,838	F554L	probably benign	Het
Stim2	T	C	5: 54,110,597	S87P	probably damaging	Het
Tcrg-C4	A	G	13: 19,344,762		probably benign	Het
Tecta	T	C	9: 42,375,185	D725G	probably damaging	Het
Ube4b	T	C	4: 149,342,992	M900V	probably damaging	Het
Ugt2b38	A	G	5: 87,411,812	M407T	probably damaging	Het
Vmn1r87	G	T	7: 13,131,865	A165E	possibly damaging	Het
Zc3h6	A	G	2: 129,014,479	H493R	possibly damaging	Het
Zfhx2	A	T	14: 55,074,775	F154Y	probably benign	Het
Zfp729a	A	G	13: 67,637,645		probably null	Het
Zfp976	A	G	7: 42,612,501		probably null	Het
Zhx1	C	G	15: 58,054,074	G259R	probably damaging	Het
Znfx1	A	T	2: 167,046,939	V783E	possibly damaging	Het

Other mutations in Dhx29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Dhx29	APN	13	112964603	missense	probably benign	0.15
IGL00434:Dhx29	APN	13	112955225	missense	probably benign	0.00
IGL00659:Dhx29	APN	13	112966635	splice site	probably benign
IGL01618:Dhx29	APN	13	112965222	missense	probably damaging	1.00
IGL01777:Dhx29	APN	13	112930872	missense	probably benign	0.42
IGL02010:Dhx29	APN	13	112966634	critical splice donor site	probably null
IGL02125:Dhx29	APN	13	112955300	splice site	probably benign
IGL02324:Dhx29	APN	13	112927808	missense	probably damaging	1.00
IGL02801:Dhx29	APN	13	112964646	missense	probably damaging	1.00
R0001:Dhx29	UTSW	13	112964556	missense	probably damaging	0.99
R0362:Dhx29	UTSW	13	112962859	missense	probably benign
R0468:Dhx29	UTSW	13	112963277	missense	probably benign
R0569:Dhx29	UTSW	13	112948214	missense	probably benign	0.01
R0714:Dhx29	UTSW	13	112927965	missense	possibly damaging	0.55
R1460:Dhx29	UTSW	13	112965210	splice site	probably benign
R1579:Dhx29	UTSW	13	112935598	critical splice donor site	probably null
R1657:Dhx29	UTSW	13	112952843	missense	probably damaging	1.00
R1735:Dhx29	UTSW	13	112945086	missense	probably benign	0.00
R1768:Dhx29	UTSW	13	112948240	missense	probably damaging	1.00
R1851:Dhx29	UTSW	13	112948281	missense	probably damaging	1.00
R1937:Dhx29	UTSW	13	112965330	missense	probably benign	0.06
R2180:Dhx29	UTSW	13	112962872	critical splice donor site	probably null
R2219:Dhx29	UTSW	13	112952804	missense	probably damaging	1.00
R2442:Dhx29	UTSW	13	112946974	missense	possibly damaging	0.94
R2679:Dhx29	UTSW	13	112947376	critical splice donor site	probably null
R2908:Dhx29	UTSW	13	112927851	missense	possibly damaging	0.78
R2912:Dhx29	UTSW	13	112935575	missense	probably damaging	1.00
R3414:Dhx29	UTSW	13	112947273	missense	probably damaging	0.99
R3931:Dhx29	UTSW	13	112958965	missense	probably damaging	1.00
R3957:Dhx29	UTSW	13	112930921	missense	probably benign
R4065:Dhx29	UTSW	13	112964742	critical splice donor site	probably null
R4207:Dhx29	UTSW	13	112927949	missense	probably benign	0.01
R4422:Dhx29	UTSW	13	112947247	missense	probably damaging	1.00
R4717:Dhx29	UTSW	13	112946935	missense	unknown
R4718:Dhx29	UTSW	13	112946935	missense	unknown
R5178:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5263:Dhx29	UTSW	13	112948221	missense	probably damaging	1.00
R5458:Dhx29	UTSW	13	112966621	missense	probably benign	0.00
R5469:Dhx29	UTSW	13	112944539	missense	possibly damaging	0.94
R5541:Dhx29	UTSW	13	112940374	missense	possibly damaging	0.47
R5573:Dhx29	UTSW	13	112933215	missense	probably benign	0.07
R5664:Dhx29	UTSW	13	112946879	missense	probably damaging	1.00
R5682:Dhx29	UTSW	13	112930849	missense	probably damaging	1.00
R5769:Dhx29	UTSW	13	112953717	missense	probably damaging	0.99
R5917:Dhx29	UTSW	13	112962843	missense	probably damaging	1.00
R5928:Dhx29	UTSW	13	112964468	missense	probably benign	0.00
R6115:Dhx29	UTSW	13	112952801	critical splice acceptor site	probably null
R6144:Dhx29	UTSW	13	112964571	missense	probably damaging	1.00
R6195:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6233:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6430:Dhx29	UTSW	13	112944619	missense	possibly damaging	0.77
R6480:Dhx29	UTSW	13	112953788	nonsense	probably null
R6527:Dhx29	UTSW	13	112932542	missense	probably damaging	1.00
R6856:Dhx29	UTSW	13	112952861	missense	probably benign	0.43
R7391:Dhx29	UTSW	13	112962859	missense	probably benign
R7555:Dhx29	UTSW	13	112927642	start gained	probably benign
R7602:Dhx29	UTSW	13	112944559	missense	possibly damaging	0.95
R8744:Dhx29	UTSW	13	112952884	missense	possibly damaging	0.54
R9281:Dhx29	UTSW	13	112941706	missense	possibly damaging	0.82
R9450:Dhx29	UTSW	13	112947328	missense	possibly damaging	0.78
R9496:Dhx29	UTSW	13	112952926	missense	probably damaging	1.00
R9716:Dhx29	UTSW	13	112945078	missense	possibly damaging	0.83
Z1177:Dhx29	UTSW	13	112955517	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGAGTCTTTAGCAGGTTACAG -3'
(R):5'- CTTACCAAGGTTTGCAGCCAC -3'

Sequencing Primer
(F):5'- TTAGCAGGTTACAGAAAATACTCCC -3'
(R):5'- AGCCACTGCCTTCTGCG -3'

Posted On

2016-06-15