Incidental Mutation 'R5125:Gm7356'
ID393520
Institutional Source Beutler Lab
Gene Symbol Gm7356
Ensembl Gene ENSMUSG00000101361
Gene Namepredicted gene 7356
Synonyms
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14000239-14001765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14001314 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 151 (D151G)
Ref Sequence ENSEMBL: ENSMUSP00000140965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186636]
Predicted Effect probably damaging
Transcript: ENSMUST00000186636
AA Change: D151G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140965
Gene: ENSMUSG00000101361
AA Change: D151G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
S_TKc 28 276 3.71e-91 SMART
UBA 296 333 1.35e-2 SMART
low complexity region 436 451 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Gm7356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02719:Gm7356 APN 17 14001275 missense probably damaging 1.00
PIT4504001:Gm7356 UTSW 17 14001458 missense probably damaging 1.00
R4533:Gm7356 UTSW 17 14001410 missense probably damaging 1.00
R4912:Gm7356 UTSW 17 14001236 missense possibly damaging 0.82
R5208:Gm7356 UTSW 17 14001194 missense probably damaging 1.00
R5342:Gm7356 UTSW 17 14001098 missense possibly damaging 0.55
R5688:Gm7356 UTSW 17 14000607 missense possibly damaging 0.79
R6002:Gm7356 UTSW 17 14000739 missense probably benign 0.00
R6478:Gm7356 UTSW 17 14001464 missense probably damaging 0.98
R6932:Gm7356 UTSW 17 14001663 missense probably damaging 1.00
R6939:Gm7356 UTSW 17 14001125 missense probably benign 0.01
R7291:Gm7356 UTSW 17 14001581 missense probably benign 0.06
R7480:Gm7356 UTSW 17 14001065 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GGGACATTTCCAACAACCATG -3'
(R):5'- TCCAAGTGATTGAGACCAAAACAAG -3'

Sequencing Primer
(F):5'- ATATCACTCCTAATGCCCATAGGTC -3'
(R):5'- TTGAGACCAAAACAAGAGGATACC -3'
Posted On2016-06-15