Incidental Mutation 'R5125:Dsg1b'
ID393522
Institutional Source Beutler Lab
Gene Symbol Dsg1b
Ensembl Gene ENSMUSG00000061928
Gene Namedesmoglein 1 beta
SynonymsDsg5
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5125 (G1)
Quality Score103
Status Not validated
Chromosome18
Chromosomal Location20376729-20410196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20397503 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 405 (G405E)
Ref Sequence ENSEMBL: ENSMUSP00000076026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076737]
Predicted Effect probably damaging
Transcript: ENSMUST00000076737
AA Change: G405E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076026
Gene: ENSMUSG00000061928
AA Change: G405E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 491 3.92e-1 SMART
low complexity region 523 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Pfam:Cadherin_C 662 784 1.6e-10 PFAM
low complexity region 789 802 N/A INTRINSIC
low complexity region 884 896 N/A INTRINSIC
low complexity region 984 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Dsg1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dsg1b APN 18 20396476 missense probably damaging 1.00
IGL00675:Dsg1b APN 18 20391918 nonsense probably null
IGL01071:Dsg1b APN 18 20409215 missense probably damaging 1.00
IGL01589:Dsg1b APN 18 20409594 missense probably damaging 1.00
IGL01729:Dsg1b APN 18 20405238 missense possibly damaging 0.66
IGL01753:Dsg1b APN 18 20397849 splice site probably benign
IGL02560:Dsg1b APN 18 20409178 missense possibly damaging 0.80
IGL02654:Dsg1b APN 18 20409262 missense probably damaging 1.00
IGL02726:Dsg1b APN 18 20399485 missense probably benign
IGL03272:Dsg1b APN 18 20397389 missense probably benign 0.25
IGL03342:Dsg1b APN 18 20409460 missense probably benign 0.09
IGL02835:Dsg1b UTSW 18 20392014 missense possibly damaging 0.66
R0080:Dsg1b UTSW 18 20397367 missense probably damaging 1.00
R0133:Dsg1b UTSW 18 20404878 missense probably damaging 0.96
R0455:Dsg1b UTSW 18 20396025 missense probably benign 0.02
R0498:Dsg1b UTSW 18 20409333 missense possibly damaging 0.95
R0518:Dsg1b UTSW 18 20388164 missense probably benign 0.00
R1418:Dsg1b UTSW 18 20397430 nonsense probably null
R1429:Dsg1b UTSW 18 20390195 missense probably damaging 1.00
R1450:Dsg1b UTSW 18 20409184 missense probably damaging 1.00
R1569:Dsg1b UTSW 18 20396480 missense probably damaging 1.00
R1674:Dsg1b UTSW 18 20399521 missense probably benign
R1934:Dsg1b UTSW 18 20395906 missense probably damaging 1.00
R2004:Dsg1b UTSW 18 20396475 missense probably damaging 0.99
R2191:Dsg1b UTSW 18 20409618 makesense probably null
R2192:Dsg1b UTSW 18 20409618 makesense probably null
R2927:Dsg1b UTSW 18 20405251 missense probably benign 0.23
R3777:Dsg1b UTSW 18 20399587 missense probably damaging 1.00
R3801:Dsg1b UTSW 18 20390203 missense probably damaging 1.00
R4205:Dsg1b UTSW 18 20408821 missense probably damaging 1.00
R4718:Dsg1b UTSW 18 20397929 missense probably damaging 0.98
R4853:Dsg1b UTSW 18 20408736 missense probably benign 0.01
R4853:Dsg1b UTSW 18 20390132 critical splice acceptor site probably null
R4981:Dsg1b UTSW 18 20408868 missense possibly damaging 0.66
R5178:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5213:Dsg1b UTSW 18 20395930 missense probably damaging 1.00
R5450:Dsg1b UTSW 18 20409064 missense probably damaging 1.00
R5605:Dsg1b UTSW 18 20399539 missense probably benign
R5778:Dsg1b UTSW 18 20409222 missense possibly damaging 0.66
R5808:Dsg1b UTSW 18 20408725 missense probably damaging 1.00
R6144:Dsg1b UTSW 18 20396419 missense possibly damaging 0.92
R6185:Dsg1b UTSW 18 20399486 missense probably benign
R6268:Dsg1b UTSW 18 20388163 missense probably benign 0.01
R6291:Dsg1b UTSW 18 20404791 missense possibly damaging 0.71
R6342:Dsg1b UTSW 18 20390243 missense probably damaging 1.00
R6449:Dsg1b UTSW 18 20394441 missense possibly damaging 0.82
R6566:Dsg1b UTSW 18 20397442 missense probably damaging 1.00
R6817:Dsg1b UTSW 18 20394405 missense probably damaging 1.00
R7235:Dsg1b UTSW 18 20399423 missense probably benign 0.01
R7857:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R7940:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R7990:Dsg1b UTSW 18 20405210 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGCTTAGTATTGGTGTTCGAAATG -3'
(R):5'- ACACTTTGCCAAATCCACTTTG -3'

Sequencing Primer
(F):5'- ATGTAGCTGAATTCCACCAGTC -3'
(R):5'- GCCAAATCCACTTTGTGCTC -3'
Posted On2016-06-15