Incidental Mutation 'R5126:Ifi213'
ID393527
Institutional Source Beutler Lab
Gene Symbol Ifi213
Ensembl Gene ENSMUSG00000073491
Gene Nameinterferon activated gene 213
SynonymsE030037K03Rik, Pydc4, Pyr-A
MMRRC Submission 042714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5126 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173566283-173599274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173590015 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 277 (V277A)
Ref Sequence ENSEMBL: ENSMUSP00000117222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097462] [ENSMUST00000150649] [ENSMUST00000180215]
Predicted Effect probably benign
Transcript: ENSMUST00000097462
SMART Domains Protein: ENSMUSP00000095070
Gene: ENSMUSG00000073491

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150649
AA Change: V277A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117222
Gene: ENSMUSG00000073491
AA Change: V277A

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180215
SMART Domains Protein: ENSMUSP00000136238
Gene: ENSMUSG00000073491

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Ifi213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Ifi213 APN 1 173594053 splice site probably benign
IGL00908:Ifi213 APN 1 173595083 missense probably damaging 1.00
IGL00964:Ifi213 APN 1 173593952 missense possibly damaging 0.91
IGL02217:Ifi213 APN 1 173595032 missense possibly damaging 0.91
R0709:Ifi213 UTSW 1 173589800 missense possibly damaging 0.70
R1518:Ifi213 UTSW 1 173589663 missense probably damaging 0.99
R1559:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R1822:Ifi213 UTSW 1 173589842 missense probably damaging 0.99
R1839:Ifi213 UTSW 1 173589600 missense probably damaging 0.98
R1989:Ifi213 UTSW 1 173568808 critical splice donor site probably null
R2108:Ifi213 UTSW 1 173569102 critical splice acceptor site probably null
R2696:Ifi213 UTSW 1 173590024 missense probably benign
R3890:Ifi213 UTSW 1 173567256 missense probably benign 0.33
R4544:Ifi213 UTSW 1 173582127 splice site probably null
R4611:Ifi213 UTSW 1 173589914 missense possibly damaging 0.91
R4689:Ifi213 UTSW 1 173590420 missense possibly damaging 0.92
R4710:Ifi213 UTSW 1 173567172 utr 3 prime probably benign
R5472:Ifi213 UTSW 1 173567272 splice site probably null
R5625:Ifi213 UTSW 1 173569063 missense possibly damaging 0.73
R5789:Ifi213 UTSW 1 173568794 splice site probably benign
R5898:Ifi213 UTSW 1 173568979 missense probably benign 0.01
R6025:Ifi213 UTSW 1 173595234 missense probably damaging 0.99
R6149:Ifi213 UTSW 1 173594015 missense probably benign 0.18
R6348:Ifi213 UTSW 1 173590282 missense possibly damaging 0.46
R6564:Ifi213 UTSW 1 173595296 start codon destroyed probably null 0.06
R7254:Ifi213 UTSW 1 173593963 missense probably damaging 0.98
R7292:Ifi213 UTSW 1 173595125 missense probably damaging 0.99
R7752:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R7901:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R8100:Ifi213 UTSW 1 173595182 missense probably damaging 1.00
R8352:Ifi213 UTSW 1 173595269 missense possibly damaging 0.92
R8425:Ifi213 UTSW 1 173589860 missense probably benign
R8452:Ifi213 UTSW 1 173595269 missense possibly damaging 0.92
RF010:Ifi213 UTSW 1 173582153 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGTTGCTGCAGACATCTG -3'
(R):5'- AGGGTTCTTCAGCACCATATTC -3'

Sequencing Primer
(F):5'- GCTGCAGACATCTGAGGACTATTAC -3'
(R):5'- ACCTGTGACAAATCTTCTCGGGTG -3'
Posted On2016-06-15