Incidental Mutation 'R5126:Adamts13'
ID393529
Institutional Source Beutler Lab
Gene Symbol Adamts13
Ensembl Gene ENSMUSG00000014852
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
SynonymsvWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
MMRRC Submission 042714-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5126 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26973416-27009628 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 26996915 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]
Predicted Effect probably null
Transcript: ENSMUST00000014996
SMART Domains Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 2.3e-11 PFAM
Pfam:Reprolysin 84 291 1e-15 PFAM
Pfam:Reprolysin_3 113 237 2e-10 PFAM
Pfam:Reprolysin_2 132 281 5e-9 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102891
SMART Domains Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 8.5e-11 PFAM
Pfam:Reprolysin 96 291 4.9e-14 PFAM
Pfam:Reprolysin_3 106 237 5.6e-11 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Blast:TSP1 1022 1079 4e-26 BLAST
TSP1 1081 1137 4.58e-4 SMART
Blast:CUB 1196 1293 2e-39 BLAST
Blast:CUB 1303 1412 3e-63 BLAST
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Adamts13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adamts13 APN 2 27005361 missense probably benign 0.04
IGL00465:Adamts13 APN 2 26973555 missense probably benign 0.32
IGL01114:Adamts13 APN 2 27005190 missense probably benign 0.41
IGL01138:Adamts13 APN 2 26983042 missense probably damaging 1.00
IGL01154:Adamts13 APN 2 27006194 missense probably benign
IGL01860:Adamts13 APN 2 26978011 missense probably damaging 0.99
IGL01924:Adamts13 APN 2 26996583 missense possibly damaging 0.80
IGL01991:Adamts13 APN 2 26990598 missense probably damaging 0.97
IGL02215:Adamts13 APN 2 26985483 missense probably damaging 1.00
IGL02415:Adamts13 APN 2 26989283 missense possibly damaging 0.95
IGL02519:Adamts13 APN 2 26978675 missense probably damaging 1.00
IGL02956:Adamts13 APN 2 26983037 missense probably benign 0.18
IGL03209:Adamts13 APN 2 26992961 missense probably benign 0.00
I1329:Adamts13 UTSW 2 26973619 missense possibly damaging 0.52
IGL02837:Adamts13 UTSW 2 26991420 missense probably benign 0.01
IGL03048:Adamts13 UTSW 2 26978699 critical splice donor site probably null
R0041:Adamts13 UTSW 2 26983974 missense probably damaging 1.00
R0217:Adamts13 UTSW 2 26996921 splice site probably benign
R0276:Adamts13 UTSW 2 26975760 missense possibly damaging 0.91
R0309:Adamts13 UTSW 2 26986989 missense probably damaging 0.99
R0348:Adamts13 UTSW 2 26981080 missense probably benign 0.13
R0369:Adamts13 UTSW 2 27005186 missense probably benign 0.00
R0386:Adamts13 UTSW 2 26986679 splice site probably null
R0553:Adamts13 UTSW 2 26991334 nonsense probably null
R0714:Adamts13 UTSW 2 26986985 splice site probably benign
R0862:Adamts13 UTSW 2 27006324 critical splice donor site probably null
R1320:Adamts13 UTSW 2 26989246 missense probably damaging 0.97
R1458:Adamts13 UTSW 2 26988354 missense probably damaging 1.00
R1473:Adamts13 UTSW 2 26981753 nonsense probably null
R1491:Adamts13 UTSW 2 26978315 missense probably damaging 1.00
R1588:Adamts13 UTSW 2 26975675 missense probably benign 0.01
R1638:Adamts13 UTSW 2 26996583 missense possibly damaging 0.80
R1724:Adamts13 UTSW 2 26991294 missense probably benign 0.00
R1924:Adamts13 UTSW 2 26984141 missense probably damaging 1.00
R2001:Adamts13 UTSW 2 26973990 missense probably benign
R2072:Adamts13 UTSW 2 27005425 missense probably benign 0.10
R2073:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R2409:Adamts13 UTSW 2 26978362 missense probably benign 0.00
R4362:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4363:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4422:Adamts13 UTSW 2 27005400 missense probably benign 0.00
R4769:Adamts13 UTSW 2 27008711 nonsense probably null
R4785:Adamts13 UTSW 2 26983042 missense probably damaging 1.00
R4831:Adamts13 UTSW 2 26983130 critical splice donor site probably null
R4832:Adamts13 UTSW 2 26989402 missense probably benign 0.22
R4945:Adamts13 UTSW 2 26986610 missense probably damaging 1.00
R5047:Adamts13 UTSW 2 26996910 missense probably damaging 0.98
R5161:Adamts13 UTSW 2 26993008 missense probably benign 0.00
R5394:Adamts13 UTSW 2 26986558 missense probably benign 0.00
R5557:Adamts13 UTSW 2 26973639 missense probably benign 0.05
R5660:Adamts13 UTSW 2 26996749 missense probably benign
R5890:Adamts13 UTSW 2 26986591 missense probably damaging 0.96
R6168:Adamts13 UTSW 2 27004886 missense probably benign 0.37
R6536:Adamts13 UTSW 2 26975750 missense probably damaging 0.99
R6929:Adamts13 UTSW 2 27006263 nonsense probably null
R7207:Adamts13 UTSW 2 26978695 missense probably damaging 1.00
R7211:Adamts13 UTSW 2 26989298 missense probably benign 0.40
R7212:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R7392:Adamts13 UTSW 2 26989324 missense probably damaging 1.00
R7583:Adamts13 UTSW 2 26973953 missense probably benign
R7604:Adamts13 UTSW 2 27005206 missense probably benign 0.00
R7783:Adamts13 UTSW 2 26990585 missense not run
R7814:Adamts13 UTSW 2 26996549 missense probably benign
R8076:Adamts13 UTSW 2 26990612 missense probably benign 0.06
R8245:Adamts13 UTSW 2 26990556 missense probably damaging 1.00
X0027:Adamts13 UTSW 2 26985546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGGTGGGAGACTCAAGTC -3'
(R):5'- CCAGGAGTTGTGATACACACTTC -3'

Sequencing Primer
(F):5'- ACTCAAGTCTTGGCACCGTG -3'
(R):5'- ACACACTTCTGAGGATCTCTGTGAG -3'
Posted On2016-06-15