Incidental Mutation 'R5126:Ahdc1'
ID393534
Institutional Source Beutler Lab
Gene Symbol Ahdc1
Ensembl Gene ENSMUSG00000037692
Gene NameAT hook, DNA binding motif, containing 1
Synonyms
MMRRC Submission 042714-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R5126 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133011260-133078110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133063522 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 691 (F691L)
Ref Sequence ENSEMBL: ENSMUSP00000101536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044521] [ENSMUST00000105914] [ENSMUST00000105915] [ENSMUST00000105916]
Predicted Effect probably benign
Transcript: ENSMUST00000044521
AA Change: F691L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047113
Gene: ENSMUSG00000037692
AA Change: F691L

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105914
AA Change: F691L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101534
Gene: ENSMUSG00000037692
AA Change: F691L

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
Pfam:DUF4683 559 639 6.4e-15 PFAM
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105915
AA Change: F691L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101535
Gene: ENSMUSG00000037692
AA Change: F691L

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105916
AA Change: F691L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101536
Gene: ENSMUSG00000037692
AA Change: F691L

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156677
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two AT-hooks, which likely function in DNA binding. Mutations in this gene were found in individuals with Xia-Gibbs syndrome. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Ahdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Ahdc1 APN 4 133063062 missense probably benign 0.33
IGL02293:Ahdc1 APN 4 133065618 missense possibly damaging 0.85
IGL02338:Ahdc1 APN 4 133062549 missense possibly damaging 0.73
IGL02828:Ahdc1 APN 4 133062921 missense possibly damaging 0.96
IGL02859:Ahdc1 APN 4 133062692 missense possibly damaging 0.53
IGL02859:Ahdc1 APN 4 133062693 missense probably damaging 0.99
IGL02901:Ahdc1 APN 4 133064934 missense possibly damaging 0.85
IGL03323:Ahdc1 APN 4 133065428 missense probably benign
FR4304:Ahdc1 UTSW 4 133062759 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062757 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062760 small insertion probably benign
FR4737:Ahdc1 UTSW 4 133062759 small insertion probably benign
R0325:Ahdc1 UTSW 4 133062719 missense unknown
R0550:Ahdc1 UTSW 4 133063037 missense probably benign 0.33
R0681:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0683:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0731:Ahdc1 UTSW 4 133062951 missense possibly damaging 0.86
R0751:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1137:Ahdc1 UTSW 4 133062113 missense possibly damaging 0.68
R1184:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1331:Ahdc1 UTSW 4 133063691 missense probably benign 0.18
R1599:Ahdc1 UTSW 4 133064936 missense possibly damaging 0.91
R2202:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2205:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2261:Ahdc1 UTSW 4 133063163 missense unknown
R2262:Ahdc1 UTSW 4 133063163 missense unknown
R3683:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3684:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3685:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3713:Ahdc1 UTSW 4 133065986 missense possibly damaging 0.85
R4027:Ahdc1 UTSW 4 133064165 missense possibly damaging 0.73
R4807:Ahdc1 UTSW 4 133064313 missense possibly damaging 0.86
R4987:Ahdc1 UTSW 4 133064320 missense possibly damaging 0.53
R5276:Ahdc1 UTSW 4 133062798 missense possibly damaging 0.93
R5680:Ahdc1 UTSW 4 133065596 missense probably benign
R5997:Ahdc1 UTSW 4 133063895 missense probably benign 0.05
R6050:Ahdc1 UTSW 4 133065891 missense possibly damaging 0.85
R6271:Ahdc1 UTSW 4 133064724 missense possibly damaging 0.73
R6410:Ahdc1 UTSW 4 133062899 missense probably damaging 0.97
R6519:Ahdc1 UTSW 4 133064768 missense possibly damaging 0.86
R6970:Ahdc1 UTSW 4 133062345 missense possibly damaging 0.96
R7199:Ahdc1 UTSW 4 133064624 missense probably benign 0.33
R7202:Ahdc1 UTSW 4 133061887 nonsense probably null
R7576:Ahdc1 UTSW 4 133065002 missense possibly damaging 0.91
R7614:Ahdc1 UTSW 4 133063514 missense probably benign 0.18
R7794:Ahdc1 UTSW 4 133063978 missense possibly damaging 0.70
R7875:Ahdc1 UTSW 4 133063850 missense possibly damaging 0.53
R8016:Ahdc1 UTSW 4 133062915 missense possibly damaging 0.96
R8295:Ahdc1 UTSW 4 133061451 start codon destroyed probably null 0.53
R8332:Ahdc1 UTSW 4 133063971 missense possibly damaging 0.85
RF017:Ahdc1 UTSW 4 133062751 small insertion probably benign
RF020:Ahdc1 UTSW 4 133064277 missense possibly damaging 0.96
T0722:Ahdc1 UTSW 4 133062754 small insertion probably benign
T0975:Ahdc1 UTSW 4 133062754 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATTCTGATGTCCTCGCCAAGC -3'
(R):5'- GAGTCCCATTCTTTCGGGAC -3'

Sequencing Primer
(F):5'- TTTTGAACCGCCAGAGTCAG -3'
(R):5'- TTCGGGACCGCCTCTTG -3'
Posted On2016-06-15