Incidental Mutation 'R5126:Pqlc2'
ID393535
Institutional Source Beutler Lab
Gene Symbol Pqlc2
Ensembl Gene ENSMUSG00000028744
Gene NamePQ loop repeat containing 2
Synonyms
MMRRC Submission 042714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5126 (G1)
Quality Score168
Status Not validated
Chromosome4
Chromosomal Location139294029-139310708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139302532 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 63 (T63A)
Ref Sequence ENSEMBL: ENSMUSP00000101427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053862] [ENSMUST00000105801] [ENSMUST00000139840] [ENSMUST00000141007] [ENSMUST00000172747]
Predicted Effect probably benign
Transcript: ENSMUST00000053862
AA Change: T63A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000059772
Gene: ENSMUSG00000028744
AA Change: T63A

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105801
AA Change: T63A

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101427
Gene: ENSMUSG00000028744
AA Change: T63A

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139840
AA Change: T63A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121362
Gene: ENSMUSG00000028744
AA Change: T63A

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141007
Predicted Effect probably benign
Transcript: ENSMUST00000172747
AA Change: T63A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134464
Gene: ENSMUSG00000028744
AA Change: T63A

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Pqlc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:Pqlc2 APN 4 139301073 missense probably benign 0.01
palanquin UTSW 4 139306441 critical splice donor site probably null
R0030:Pqlc2 UTSW 4 139306453 missense probably damaging 1.00
R0332:Pqlc2 UTSW 4 139300299 missense possibly damaging 0.68
R1558:Pqlc2 UTSW 4 139300080 intron probably benign
R2157:Pqlc2 UTSW 4 139301855 missense probably damaging 1.00
R2518:Pqlc2 UTSW 4 139302499 missense probably damaging 1.00
R3079:Pqlc2 UTSW 4 139306518 missense probably damaging 1.00
R3778:Pqlc2 UTSW 4 139298982 splice site probably null
R4401:Pqlc2 UTSW 4 139306543 missense probably benign 0.19
R4783:Pqlc2 UTSW 4 139300001 missense probably benign 0.00
R4784:Pqlc2 UTSW 4 139300001 missense probably benign 0.00
R4785:Pqlc2 UTSW 4 139300001 missense probably benign 0.00
R4879:Pqlc2 UTSW 4 139301784 splice site probably null
R5540:Pqlc2 UTSW 4 139300344 missense probably damaging 0.99
R5700:Pqlc2 UTSW 4 139300254 missense probably damaging 1.00
R6141:Pqlc2 UTSW 4 139300245 missense probably benign 0.32
R6379:Pqlc2 UTSW 4 139299985 missense probably benign 0.02
R6905:Pqlc2 UTSW 4 139306441 critical splice donor site probably null
R7315:Pqlc2 UTSW 4 139301870 missense probably damaging 1.00
R7499:Pqlc2 UTSW 4 139306512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGACATATTTGAAGCCCC -3'
(R):5'- AGAATTCCTCCACAGGTCAAAG -3'

Sequencing Primer
(F):5'- TGACATATTTGAAGCCCCAGACTC -3'
(R):5'- TCCGTCAGAGGATAATACTGCCTG -3'
Posted On2016-06-15