Incidental Mutation 'R5126:Dnajc16'
ID 393536
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 4732437J24Rik, 2900037O03Rik
MMRRC Submission 042714-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.736) question?
Stock # R5126 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 141760189-141790931 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 141774509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 337 (V337L)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000038014
AA Change: V337L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: V337L

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138654
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141763563 splice site probably null
IGL00840:Dnajc16 APN 4 141768003 missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141763697 missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141774629 missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141776933 missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141764647 missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141767732 nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141770949 missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141764685 missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141768007 missense probably benign
R0415:Dnajc16 UTSW 4 141789048 nonsense probably null
R0532:Dnajc16 UTSW 4 141789009 missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141767741 nonsense probably null
R2959:Dnajc16 UTSW 4 141766545 nonsense probably null
R3025:Dnajc16 UTSW 4 141774611 missense probably benign
R3796:Dnajc16 UTSW 4 141767737 missense probably benign
R3854:Dnajc16 UTSW 4 141763653 nonsense probably null
R3856:Dnajc16 UTSW 4 141763653 nonsense probably null
R4661:Dnajc16 UTSW 4 141763548 missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141767969 nonsense probably null
R5140:Dnajc16 UTSW 4 141764683 missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141775392 missense probably benign
R6888:Dnajc16 UTSW 4 141776992 missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141766690 missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141763813 missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141774568 missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141764691 missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141766707 nonsense probably null
R9005:Dnajc16 UTSW 4 141764634 missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141783060 missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141767747 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCTGTTTTGTTCAATTCCCAACAC -3'
(R):5'- GGATGCCAAGCTGTCATTTCC -3'

Sequencing Primer
(F):5'- GACCCACAGCAGTTGGTCTTTG -3'
(R):5'- GCCAAGCTGTCATTTCCCTTCC -3'
Posted On 2016-06-15