Incidental Mutation 'R5126:Dnajc16'
ID 393536
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
MMRRC Submission 042714-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.772) question?
Stock # R5126 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 141501820 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 337 (V337L)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000038014
AA Change: V337L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: V337L

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138654
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,886,927 (GRCm39) probably null Het
Ahdc1 T A 4: 132,790,833 (GRCm39) F691L probably benign Het
Ahsa2 T A 11: 23,441,036 (GRCm39) I202F possibly damaging Het
Akap10 C T 11: 61,807,015 (GRCm39) A72T probably damaging Het
Ccnb1 C G 13: 100,918,283 (GRCm39) Q121H possibly damaging Het
Cep164 A G 9: 45,698,722 (GRCm39) probably null Het
Cltc A G 11: 86,603,495 (GRCm39) V781A probably damaging Het
Dchs1 A G 7: 105,402,724 (GRCm39) S3273P probably damaging Het
Fstl4 T C 11: 53,077,388 (GRCm39) V715A possibly damaging Het
Grik1 C T 16: 87,744,747 (GRCm39) G502S probably damaging Het
Ifi213 A G 1: 173,417,581 (GRCm39) V277A possibly damaging Het
Ints15 G T 5: 143,293,701 (GRCm39) P259T probably benign Het
Jph3 T C 8: 122,479,787 (GRCm39) V155A possibly damaging Het
Katnal2 T C 18: 77,105,294 (GRCm39) E51G probably benign Het
Kcna2 T A 3: 107,011,550 (GRCm39) F44I probably damaging Het
Kcna6 T C 6: 126,715,695 (GRCm39) E398G probably damaging Het
Kif15 A T 9: 122,804,823 (GRCm39) H190L probably damaging Het
Lmbrd2 A G 15: 9,194,788 (GRCm39) R597G possibly damaging Het
Lrtm2 T A 6: 119,294,400 (GRCm39) M244L probably benign Het
Ly6c2 A C 15: 74,983,492 (GRCm39) S9A possibly damaging Het
Mbd4 T A 6: 115,825,929 (GRCm39) probably null Het
Mfsd2b A G 12: 4,916,183 (GRCm39) I269T probably benign Het
Muc6 A T 7: 141,237,564 (GRCm39) C218S probably damaging Het
Nlrc5 G T 8: 95,201,299 (GRCm39) R131L possibly damaging Het
Nlrp1b A T 11: 71,072,359 (GRCm39) C495S possibly damaging Het
Nsf C A 11: 103,773,618 (GRCm39) E299* probably null Het
Obscn T A 11: 58,967,889 (GRCm39) E336D probably damaging Het
Or14j9 G T 17: 37,874,719 (GRCm39) T161K probably benign Het
Pan3 A G 5: 147,464,008 (GRCm39) N587S probably benign Het
Pgap6 T C 17: 26,340,614 (GRCm39) I666T probably damaging Het
Plch2 T C 4: 155,084,976 (GRCm39) D321G probably damaging Het
Plscr4 G A 9: 92,370,794 (GRCm39) D254N probably damaging Het
Pnma8a A C 7: 16,695,242 (GRCm39) M366L probably benign Het
Pnpla7 G T 2: 24,870,056 (GRCm39) C12F possibly damaging Het
Ptprk G T 10: 28,451,640 (GRCm39) probably null Het
Rgs22 A G 15: 36,040,790 (GRCm39) V899A probably damaging Het
Ruvbl1 T A 6: 88,462,883 (GRCm39) C336S probably benign Het
Slc27a5 T A 7: 12,725,247 (GRCm39) H400L probably damaging Het
Slc66a1 T C 4: 139,029,843 (GRCm39) T63A probably benign Het
Slco1a4 A T 6: 141,761,308 (GRCm39) V435D possibly damaging Het
Snx14 A T 9: 88,264,152 (GRCm39) Y818N probably damaging Het
Tln2 A G 9: 67,165,817 (GRCm39) I2098T probably damaging Het
Tlr11 T C 14: 50,598,287 (GRCm39) L91P probably damaging Het
Tmem208 T A 8: 106,061,282 (GRCm39) F103I probably benign Het
Vmn2r3 C T 3: 64,166,740 (GRCm39) C797Y probably damaging Het
Vwde T A 6: 13,187,259 (GRCm39) M743L probably benign Het
Wdcp C A 12: 4,900,617 (GRCm39) R158S probably damaging Het
Zfp773 T C 7: 7,139,623 (GRCm39) T9A unknown Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141,491,996 (GRCm39) missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141,495,052 (GRCm39) nonsense probably null
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3025:Dnajc16 UTSW 4 141,501,922 (GRCm39) missense probably benign
R3796:Dnajc16 UTSW 4 141,495,048 (GRCm39) missense probably benign
R3854:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141,494,001 (GRCm39) missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141,491,124 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141,494,018 (GRCm39) nonsense probably null
R9005:Dnajc16 UTSW 4 141,491,945 (GRCm39) missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141,495,058 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCTGTTTTGTTCAATTCCCAACAC -3'
(R):5'- GGATGCCAAGCTGTCATTTCC -3'

Sequencing Primer
(F):5'- GACCCACAGCAGTTGGTCTTTG -3'
(R):5'- GCCAAGCTGTCATTTCCCTTCC -3'
Posted On 2016-06-15