Incidental Mutation 'R5126:Pan3'
ID393539
Institutional Source Beutler Lab
Gene Symbol Pan3
Ensembl Gene ENSMUSG00000029647
Gene NamePAN3 poly(A) specific ribonuclease subunit
Synonyms2700050F09Rik, A430027N15Rik
MMRRC Submission 042714-MU
Accession Numbers

Genbank: NM_028291.4; Ensembl: ENSMUST00000031651

Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R5126 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location147430161-147548502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147527198 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 587 (N587S)
Ref Sequence ENSEMBL: ENSMUSP00000135367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031651] [ENSMUST00000175807] [ENSMUST00000176600]
Predicted Effect probably benign
Transcript: ENSMUST00000031651
AA Change: N533S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031651
Gene: ENSMUSG00000029647
AA Change: N533S

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
PDB:4BWP|B 391 829 1e-161 PDB
Blast:S_TKc 439 607 2e-8 BLAST
SCOP:d1pme__ 453 602 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175807
AA Change: N154S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135729
Gene: ENSMUSG00000029647
AA Change: N154S

DomainStartEndE-ValueType
PDB:4BWP|B 51 450 1e-134 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176505
Predicted Effect probably benign
Transcript: ENSMUST00000176596
Predicted Effect probably benign
Transcript: ENSMUST00000176600
AA Change: N587S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135367
Gene: ENSMUSG00000029647
AA Change: N587S

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
PDB:4BWP|B 445 883 1e-161 PDB
Blast:S_TKc 493 661 2e-8 BLAST
SCOP:d1pme__ 507 656 4e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000176753
AA Change: N387S
SMART Domains Protein: ENSMUSP00000134989
Gene: ENSMUSG00000029647
AA Change: N387S

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
low complexity region 173 190 N/A INTRINSIC
PDB:4BWP|B 246 684 1e-164 PDB
Blast:S_TKc 294 462 1e-8 BLAST
SCOP:d1pme__ 308 457 8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177328
Predicted Effect probably benign
Transcript: ENSMUST00000177465
SMART Domains Protein: ENSMUSP00000134810
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202732
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI

 All alleles(15) : Gene trapped(15)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Pan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Pan3 APN 5 147529973 missense probably benign 0.05
IGL01612:Pan3 APN 5 147453242 splice site probably benign
IGL02187:Pan3 APN 5 147526588 missense probably benign 0.21
IGL02324:Pan3 APN 5 147530123 splice site probably null
IGL02328:Pan3 APN 5 147530123 splice site probably null
IGL02507:Pan3 APN 5 147526596 missense probably damaging 0.98
IGL03144:Pan3 APN 5 147450781 splice site probably benign
3-1:Pan3 UTSW 5 147526575 missense probably benign 0.14
R2145:Pan3 UTSW 5 147530098 missense possibly damaging 0.87
R2174:Pan3 UTSW 5 147450653 missense possibly damaging 0.63
R2504:Pan3 UTSW 5 147527036 missense possibly damaging 0.87
R3106:Pan3 UTSW 5 147539379 splice site probably benign
R3723:Pan3 UTSW 5 147503208 intron probably benign
R3944:Pan3 UTSW 5 147450730 missense probably damaging 1.00
R4589:Pan3 UTSW 5 147543173 missense probably damaging 0.98
R4647:Pan3 UTSW 5 147527203 missense probably damaging 1.00
R4811:Pan3 UTSW 5 147530058 missense probably damaging 1.00
R5001:Pan3 UTSW 5 147526682 critical splice donor site probably null
R5215:Pan3 UTSW 5 147455105 splice site probably null
R5317:Pan3 UTSW 5 147543210 critical splice donor site probably null
R5496:Pan3 UTSW 5 147527128 critical splice acceptor site probably null
R5687:Pan3 UTSW 5 147455172 missense probably damaging 1.00
R6147:Pan3 UTSW 5 147548283 unclassified probably benign
R6539:Pan3 UTSW 5 147450653 missense possibly damaging 0.63
R7008:Pan3 UTSW 5 147545693 missense probably damaging 0.99
R7047:Pan3 UTSW 5 147546365 missense probably damaging 0.97
R7226:Pan3 UTSW 5 147526992 missense probably damaging 1.00
R7424:Pan3 UTSW 5 147536272 intron probably null
R7453:Pan3 UTSW 5 147526681 critical splice donor site probably null
R8062:Pan3 UTSW 5 147527150 missense probably benign 0.18
X0060:Pan3 UTSW 5 147543133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAACTCTGCGTGAAGTGTTTAC -3'
(R):5'- TTTCCTAACTTGCTGCAAACCAAC -3'

Sequencing Primer
(F):5'- GTTTACCACTAAAGCATTTGCCGAG -3'
(R):5'- TGCAAACCAACTCCAATTCTTTGAG -3'
Posted On2016-06-15