Incidental Mutation 'R5126:Mbd4'
ID393542
Institutional Source Beutler Lab
Gene Symbol Mbd4
Ensembl Gene ENSMUSG00000030322
Gene Namemethyl-CpG binding domain protein 4
SynonymsMed1
MMRRC Submission 042714-MU
Accession Numbers

Ncbi RefSeq: NM_010774.2; MGI:1333850

Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5126 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115840697-115853371 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 115848968 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032469] [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000122816] [ENSMUST00000141305] [ENSMUST00000147282] [ENSMUST00000203643]
Predicted Effect probably benign
Transcript: ENSMUST00000032469
AA Change: D354V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032469
Gene: ENSMUSG00000030322
AA Change: D354V

DomainStartEndE-ValueType
MBD 66 142 1.25e-29 SMART
low complexity region 178 196 N/A INTRINSIC
PDB:1NGN|A 400 554 1e-111 PDB
SCOP:d1keaa_ 405 545 1e-23 SMART
Blast:ENDO3c 439 514 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038234
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112923
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112925
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122816
AA Change: D354V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145433
Gene: ENSMUSG00000030322
AA Change: D354V

DomainStartEndE-ValueType
MBD 66 142 7.6e-32 SMART
low complexity region 178 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133830
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147282
AA Change: D333V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125619
Gene: ENSMUSG00000030322
AA Change: D333V

DomainStartEndE-ValueType
MBD 45 121 1.25e-29 SMART
low complexity region 157 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203243
Predicted Effect probably null
Transcript: ENSMUST00000203643
SMART Domains Protein: ENSMUSP00000144930
Gene: ENSMUSG00000030322

DomainStartEndE-ValueType
Pfam:HhH-GPD 56 168 2.7e-5 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype Strain: 2447611
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele have an increased rate of DNA mutation, specifically at CpGs. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(6) Gene trapped(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Mbd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mbd4 APN 6 115849530 missense probably damaging 0.99
IGL01545:Mbd4 APN 6 115850797 missense probably damaging 1.00
IGL01657:Mbd4 APN 6 115849637 missense probably damaging 0.99
IGL02406:Mbd4 APN 6 115849025 missense possibly damaging 0.96
E0370:Mbd4 UTSW 6 115849155 missense possibly damaging 0.91
R0025:Mbd4 UTSW 6 115844568 critical splice donor site probably null
R0025:Mbd4 UTSW 6 115844568 critical splice donor site probably null
R0538:Mbd4 UTSW 6 115849482 missense probably damaging 0.99
R2085:Mbd4 UTSW 6 115848957 missense probably benign 0.01
R4405:Mbd4 UTSW 6 115849115 missense possibly damaging 0.92
R4464:Mbd4 UTSW 6 115849502 missense probably damaging 0.99
R4780:Mbd4 UTSW 6 115849384 missense probably benign
R4782:Mbd4 UTSW 6 115845322 missense possibly damaging 0.49
R4799:Mbd4 UTSW 6 115845322 missense probably benign 0.26
R4814:Mbd4 UTSW 6 115849299 missense possibly damaging 0.85
R4860:Mbd4 UTSW 6 115848926 missense possibly damaging 0.51
R4860:Mbd4 UTSW 6 115848926 missense possibly damaging 0.51
R4976:Mbd4 UTSW 6 115850724 missense possibly damaging 0.95
R5202:Mbd4 UTSW 6 115849402 missense probably damaging 0.96
R5485:Mbd4 UTSW 6 115850718 missense probably benign 0.21
R6179:Mbd4 UTSW 6 115845425 missense probably benign 0.00
R6661:Mbd4 UTSW 6 115849155 nonsense probably null
R7008:Mbd4 UTSW 6 115850724 missense possibly damaging 0.95
R7244:Mbd4 UTSW 6 115844603 missense probably benign 0.00
R7723:Mbd4 UTSW 6 115845363 missense possibly damaging 0.47
R7755:Mbd4 UTSW 6 115844585 missense probably damaging 0.99
R7837:Mbd4 UTSW 6 115849539 missense probably benign 0.20
R8032:Mbd4 UTSW 6 115844633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGAGAATATATCTGACGCTTG -3'
(R):5'- CTGTGCAAGGGAGACTGTTG -3'

Sequencing Primer
(F):5'- GAATATATCTGACGCTTGACTCTTC -3'
(R):5'- CAAGGGAGACTGTTGGCCTG -3'
Posted On2016-06-15