Incidental Mutation 'R5126:Cltc'
ID393569
Institutional Source Beutler Lab
Gene Symbol Cltc
Ensembl Gene ENSMUSG00000047126
Gene Nameclathrin, heavy polypeptide (Hc)
SynonymsCHC
MMRRC Submission 042714-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5126 (G1)
Quality Score182
Status Not validated
Chromosome11
Chromosomal Location86694351-86757565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86712669 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 781 (V781A)
Ref Sequence ENSEMBL: ENSMUSP00000050220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186]
Predicted Effect probably damaging
Transcript: ENSMUST00000060766
AA Change: V781A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126
AA Change: V781A

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 5.3e-10 PFAM
Pfam:Clathrin_propel 152 191 1.5e-11 PFAM
Pfam:Clathrin_propel 202 238 1.2e-11 PFAM
Pfam:Clathrin_propel 257 292 2.2e-8 PFAM
Pfam:Clathrin_propel 300 334 8.6e-10 PFAM
Pfam:Clathrin-link 335 358 1.7e-17 PFAM
Pfam:Clathrin_H_link 360 425 7.1e-35 PFAM
low complexity region 449 462 N/A INTRINSIC
CLH 541 683 1.65e-41 SMART
CLH 690 832 1.24e-45 SMART
CLH 837 976 6.68e-42 SMART
CLH 983 1128 7.21e-47 SMART
CLH 1132 1273 7.91e-44 SMART
CLH 1278 1424 1.59e-48 SMART
CLH 1427 1586 8.36e-43 SMART
low complexity region 1666 1677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103186
AA Change: V777A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126
AA Change: V777A

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 2e-7 PFAM
Pfam:Clathrin_propel 148 187 3.8e-9 PFAM
Pfam:Clathrin_propel 198 234 3.8e-9 PFAM
Pfam:Clathrin-link 331 354 3.5e-17 PFAM
Pfam:Clathrin_H_link 356 421 1.9e-35 PFAM
low complexity region 445 458 N/A INTRINSIC
CLH 537 679 1.65e-41 SMART
CLH 686 828 1.24e-45 SMART
CLH 833 972 6.68e-42 SMART
CLH 979 1124 7.21e-47 SMART
CLH 1128 1269 7.91e-44 SMART
CLH 1274 1420 1.59e-48 SMART
CLH 1423 1582 8.36e-43 SMART
low complexity region 1662 1673 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Cltc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Cltc APN 11 86702248 missense probably benign 0.43
IGL01503:Cltc APN 11 86695700 splice site probably benign
IGL01649:Cltc APN 11 86726400 missense probably benign 0.16
IGL01896:Cltc APN 11 86725133 missense probably damaging 1.00
IGL02005:Cltc APN 11 86730219 missense possibly damaging 0.86
IGL02125:Cltc APN 11 86704810 unclassified probably benign
IGL02166:Cltc APN 11 86704088 missense probably benign 0.00
IGL02186:Cltc APN 11 86704985 missense possibly damaging 0.55
IGL02186:Cltc APN 11 86704986 missense possibly damaging 0.55
IGL02214:Cltc APN 11 86732586 missense probably benign 0.08
IGL02227:Cltc APN 11 86697340 missense possibly damaging 0.85
IGL02471:Cltc APN 11 86718034 missense probably damaging 1.00
IGL02607:Cltc APN 11 86706714 missense probably benign 0.00
IGL02888:Cltc APN 11 86757297 utr 5 prime probably benign
IGL03226:Cltc APN 11 86720287 missense probably damaging 1.00
IGL03337:Cltc APN 11 86703683 missense possibly damaging 0.95
Buckey UTSW 11 86720362 missense probably benign 0.01
fuller UTSW 11 86704160 missense possibly damaging 0.79
Geodesic UTSW 11 86733630 missense probably damaging 0.97
R0468:Cltc UTSW 11 86704626 unclassified probably benign
R0487:Cltc UTSW 11 86733664 missense probably damaging 1.00
R0515:Cltc UTSW 11 86709039 missense probably benign 0.25
R0631:Cltc UTSW 11 86712613 missense probably benign 0.03
R0759:Cltc UTSW 11 86737082 missense probably null 0.91
R1635:Cltc UTSW 11 86757279 missense probably benign 0.00
R1671:Cltc UTSW 11 86732595 missense possibly damaging 0.88
R1695:Cltc UTSW 11 86701060 critical splice donor site probably null
R1737:Cltc UTSW 11 86733727 missense probably damaging 1.00
R1747:Cltc UTSW 11 86707081 missense probably damaging 1.00
R1880:Cltc UTSW 11 86712631 missense probably damaging 1.00
R2291:Cltc UTSW 11 86733622 missense probably benign 0.35
R3031:Cltc UTSW 11 86730332 missense probably damaging 1.00
R4012:Cltc UTSW 11 86757261 missense probably benign 0.12
R4022:Cltc UTSW 11 86720348 missense probably damaging 0.96
R4394:Cltc UTSW 11 86733630 missense probably damaging 0.97
R4654:Cltc UTSW 11 86726370 missense probably benign 0.10
R4807:Cltc UTSW 11 86701076 intron probably benign
R4837:Cltc UTSW 11 86695648 missense probably benign 0.00
R4965:Cltc UTSW 11 86707501 missense probably damaging 0.99
R5072:Cltc UTSW 11 86717968 missense possibly damaging 0.86
R5113:Cltc UTSW 11 86722321 missense probably damaging 0.98
R5177:Cltc UTSW 11 86705163 missense probably damaging 1.00
R5609:Cltc UTSW 11 86730267 missense probably damaging 0.99
R5610:Cltc UTSW 11 86721646 missense probably benign 0.00
R5677:Cltc UTSW 11 86705242 missense probably damaging 1.00
R5999:Cltc UTSW 11 86704129 missense possibly damaging 0.93
R6197:Cltc UTSW 11 86720362 missense probably benign 0.01
R6198:Cltc UTSW 11 86720362 missense probably benign 0.01
R6264:Cltc UTSW 11 86705258 missense probably damaging 1.00
R6395:Cltc UTSW 11 86725180 missense probably damaging 0.97
R6818:Cltc UTSW 11 86704228 missense possibly damaging 0.86
R6894:Cltc UTSW 11 86712602 nonsense probably null
R7196:Cltc UTSW 11 86706831 missense probably damaging 1.00
R7438:Cltc UTSW 11 86725228 missense probably benign 0.01
R7621:Cltc UTSW 11 86707486 missense probably benign 0.03
R7637:Cltc UTSW 11 86730332 missense probably damaging 1.00
R7729:Cltc UTSW 11 86721648 missense probably benign
R7769:Cltc UTSW 11 86719493 missense probably damaging 1.00
R7817:Cltc UTSW 11 86725123 missense probably damaging 1.00
R7944:Cltc UTSW 11 86737141 missense probably benign 0.01
R7945:Cltc UTSW 11 86737141 missense probably benign 0.01
R8040:Cltc UTSW 11 86725205 missense probably damaging 1.00
R8105:Cltc UTSW 11 86707612 missense probably damaging 0.98
R8203:Cltc UTSW 11 86704160 missense possibly damaging 0.79
R8297:Cltc UTSW 11 86712631 missense probably damaging 1.00
R8304:Cltc UTSW 11 86725261 missense probably benign 0.01
R8419:Cltc UTSW 11 86707566 missense probably benign 0.01
R8673:Cltc UTSW 11 86757375 start gained probably benign
Z1176:Cltc UTSW 11 86702632 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CTTCACATTCTGGCATGGATG -3'
(R):5'- AGAAGGACATGCAGCCTTGG -3'

Sequencing Primer
(F):5'- TACTCTAGCAGACCATTCTTACCAGG -3'
(R):5'- CATGCAGCCTTGGGGTCATTTG -3'
Posted On2016-06-15