Incidental Mutation 'R5126:Lmbrd2'
ID393577
Institutional Source Beutler Lab
Gene Symbol Lmbrd2
Ensembl Gene ENSMUSG00000039704
Gene NameLMBR1 domain containing 2
Synonyms9930036E21Rik
MMRRC Submission 042714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R5126 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location9140550-9202483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9194701 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 597 (R597G)
Ref Sequence ENSEMBL: ENSMUSP00000087858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090380] [ENSMUST00000227556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090380
AA Change: R597G

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087858
Gene: ENSMUSG00000039704
AA Change: R597G

DomainStartEndE-ValueType
Pfam:LMBR1 8 546 4.2e-192 PFAM
low complexity region 574 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227556
AA Change: R642G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Lmbrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Lmbrd2 APN 15 9157295 missense probably damaging 1.00
IGL00864:Lmbrd2 APN 15 9175210 missense probably damaging 1.00
IGL01554:Lmbrd2 APN 15 9165819 missense possibly damaging 0.96
IGL02142:Lmbrd2 APN 15 9186685 missense probably damaging 1.00
IGL02176:Lmbrd2 APN 15 9182574 missense probably damaging 1.00
IGL02293:Lmbrd2 APN 15 9172189 missense probably benign
IGL02692:Lmbrd2 APN 15 9149068 missense possibly damaging 0.94
IGL03101:Lmbrd2 APN 15 9186608 missense probably damaging 1.00
R0102:Lmbrd2 UTSW 15 9183952 missense probably damaging 1.00
R0370:Lmbrd2 UTSW 15 9165852 missense probably damaging 0.97
R0379:Lmbrd2 UTSW 15 9149479 missense probably benign 0.00
R0513:Lmbrd2 UTSW 15 9194729 missense probably damaging 1.00
R1610:Lmbrd2 UTSW 15 9186612 missense probably benign 0.19
R1628:Lmbrd2 UTSW 15 9182506 missense probably damaging 1.00
R1844:Lmbrd2 UTSW 15 9177751 nonsense probably null
R2422:Lmbrd2 UTSW 15 9194765 missense possibly damaging 0.83
R3614:Lmbrd2 UTSW 15 9177711 missense probably damaging 1.00
R3924:Lmbrd2 UTSW 15 9149537 missense probably benign
R4014:Lmbrd2 UTSW 15 9151585 splice site probably benign
R4298:Lmbrd2 UTSW 15 9165795 missense possibly damaging 0.92
R5699:Lmbrd2 UTSW 15 9175182 missense probably benign 0.40
R5841:Lmbrd2 UTSW 15 9182570 missense possibly damaging 0.94
R5974:Lmbrd2 UTSW 15 9172115 missense probably benign 0.25
R5988:Lmbrd2 UTSW 15 9182406 intron probably null
R6179:Lmbrd2 UTSW 15 9149175 missense probably damaging 0.99
R6666:Lmbrd2 UTSW 15 9151569 missense probably benign 0.06
R7180:Lmbrd2 UTSW 15 9175196 missense possibly damaging 0.90
R7269:Lmbrd2 UTSW 15 9194684 missense probably damaging 1.00
R7341:Lmbrd2 UTSW 15 9165819 missense possibly damaging 0.96
R8066:Lmbrd2 UTSW 15 9172085 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACTACCTGGTCTGAGCTAGC -3'
(R):5'- TACAAGCTCCTTATATCAGCTCATC -3'

Sequencing Primer
(F):5'- ACTACCTGGTCTGAGCTAGCTAGATG -3'
(R):5'- AGCTCATCATTAAAATCTCAGAAGC -3'
Posted On2016-06-15