Incidental Mutation 'R5126:Grik1'
ID393580
Institutional Source Beutler Lab
Gene Symbol Grik1
Ensembl Gene ENSMUSG00000022935
Gene Nameglutamate receptor, ionotropic, kainate 1
SynonymsGlurbeta1, Glur5, D16Ium24e, Glur-5, D16Ium24, GluK5, A830007B11Rik
MMRRC Submission 042714-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5126 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location87895900-88290265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87947859 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 502 (G502S)
Ref Sequence ENSEMBL: ENSMUSP00000154130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023652] [ENSMUST00000072256] [ENSMUST00000114137] [ENSMUST00000211444] [ENSMUST00000227986] [ENSMUST00000228034] [ENSMUST00000228188]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023652
AA Change: G487S

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023652
Gene: ENSMUSG00000022935
AA Change: G487S

DomainStartEndE-ValueType
Pfam:ANF_receptor 14 357 4.7e-69 PFAM
Pfam:Peripla_BP_6 48 347 5.1e-11 PFAM
PBPe 394 762 2.4e-130 SMART
Lig_chan-Glu_bd 404 468 6.34e-31 SMART
Blast:PBPe 770 815 2e-16 BLAST
low complexity region 829 850 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072256
AA Change: G487S

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072107
Gene: ENSMUSG00000022935
AA Change: G487S

DomainStartEndE-ValueType
Pfam:ANF_receptor 14 357 2.6e-72 PFAM
Pfam:Peripla_BP_6 49 347 3.4e-10 PFAM
PBPe 394 762 2.4e-130 SMART
Lig_chan-Glu_bd 404 468 6.34e-31 SMART
Blast:PBPe 770 817 1e-17 BLAST
low complexity region 858 879 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114137
AA Change: G416S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109773
Gene: ENSMUSG00000022935
AA Change: G416S

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 325 5.4e-63 PFAM
Pfam:Peripla_BP_6 18 315 5.1e-11 PFAM
PBPe 362 730 2.4e-130 SMART
Lig_chan-Glu_bd 372 436 6.34e-31 SMART
Blast:PBPe 738 783 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210910
Predicted Effect probably damaging
Transcript: ENSMUST00000211444
AA Change: G487S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226447
Predicted Effect probably damaging
Transcript: ENSMUST00000227986
AA Change: G502S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228034
AA Change: G502S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228188
AA Change: G502S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to alter the properties of ion flow. Alternative splicing, resulting in transcript variants encoding different isoforms, has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile abnormalities in the electrophysiology of neurons in the brain. Response to chemical pain stimuli is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Grik1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Grik1 APN 16 87957600 splice site probably null
IGL01347:Grik1 APN 16 87957593 missense probably benign 0.00
IGL01612:Grik1 APN 16 87946735 missense probably damaging 1.00
IGL02010:Grik1 APN 16 88051508 missense possibly damaging 0.96
IGL02059:Grik1 APN 16 88056049 missense possibly damaging 0.95
IGL02068:Grik1 APN 16 87940651 missense possibly damaging 0.80
IGL02200:Grik1 APN 16 87940565 missense probably damaging 1.00
IGL02206:Grik1 APN 16 87935920 missense probably damaging 1.00
IGL02375:Grik1 APN 16 87946556 missense probably damaging 1.00
IGL02598:Grik1 APN 16 87947984 missense probably damaging 1.00
IGL02686:Grik1 APN 16 88009761 splice site probably null
IGL02890:Grik1 APN 16 87896802 intron probably benign
R0096:Grik1 UTSW 16 88034226 missense possibly damaging 0.55
R0096:Grik1 UTSW 16 88034226 missense possibly damaging 0.55
R0387:Grik1 UTSW 16 88034350 splice site probably benign
R0613:Grik1 UTSW 16 88051333 critical splice donor site probably null
R1087:Grik1 UTSW 16 88006377 missense probably benign 0.00
R1694:Grik1 UTSW 16 87950068 missense probably damaging 0.96
R1905:Grik1 UTSW 16 87896866 nonsense probably null
R1928:Grik1 UTSW 16 88051353 missense probably damaging 0.99
R2157:Grik1 UTSW 16 88056124 missense probably damaging 1.00
R3122:Grik1 UTSW 16 88006473 missense probably damaging 1.00
R3906:Grik1 UTSW 16 88006449 missense probably benign 0.00
R4194:Grik1 UTSW 16 87946728 missense probably benign 0.45
R4343:Grik1 UTSW 16 87896252 missense probably benign 0.00
R4349:Grik1 UTSW 16 87957543 missense probably damaging 1.00
R4416:Grik1 UTSW 16 88051461 missense probably benign 0.00
R4423:Grik1 UTSW 16 87923200 missense probably benign 0.10
R4660:Grik1 UTSW 16 87923131 missense probably damaging 1.00
R4804:Grik1 UTSW 16 87957569 missense probably damaging 0.99
R5052:Grik1 UTSW 16 87950098 missense probably benign 0.01
R5334:Grik1 UTSW 16 87923194 frame shift probably null
R5335:Grik1 UTSW 16 87923194 frame shift probably null
R5337:Grik1 UTSW 16 87923194 frame shift probably null
R5479:Grik1 UTSW 16 87936026 missense probably damaging 1.00
R6141:Grik1 UTSW 16 87896872 missense probably benign 0.00
R6188:Grik1 UTSW 16 88056071 missense probably benign 0.06
R6335:Grik1 UTSW 16 87947906 missense probably damaging 1.00
R6610:Grik1 UTSW 16 88034312 missense probably damaging 1.00
R6737:Grik1 UTSW 16 88051391 missense probably damaging 1.00
R7275:Grik1 UTSW 16 87912820 missense probably benign 0.06
R7876:Grik1 UTSW 16 87923233 missense
R8021:Grik1 UTSW 16 87914222 missense
R8027:Grik1 UTSW 16 87936005 missense
R8096:Grik1 UTSW 16 88006467 missense
R8266:Grik1 UTSW 16 87947979 missense probably benign
R8515:Grik1 UTSW 16 87923282 nonsense probably null
RF016:Grik1 UTSW 16 88034186 missense
RF022:Grik1 UTSW 16 87896337 missense
X0018:Grik1 UTSW 16 87946596 missense probably damaging 1.00
Z1177:Grik1 UTSW 16 87946684 missense
Predicted Primers PCR Primer
(F):5'- ACCTCTCAAGCTTACTCACGTAATG -3'
(R):5'- TAACAGAGCTTCCATGCCCG -3'

Sequencing Primer
(F):5'- TGTGTGTGTGTAAACATGGAAC -3'
(R):5'- GAGCTTCCATGCCCGGTTTG -3'
Posted On2016-06-15