Incidental Mutation 'R5126:Olfr112'
ID393582
Institutional Source Beutler Lab
Gene Symbol Olfr112
Ensembl Gene ENSMUSG00000051611
Gene Nameolfactory receptor 112
Synonyms4930580F03Rik, GA_x6K02T2PSCP-2023769-2022807, MOR218-4
MMRRC Submission 042714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5126 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37561668-37569451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37563828 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 161 (T161K)
Ref Sequence ENSEMBL: ENSMUSP00000150904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085548] [ENSMUST00000174798] [ENSMUST00000208832] [ENSMUST00000213274]
Predicted Effect probably benign
Transcript: ENSMUST00000085548
AA Change: T161K

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082684
Gene: ENSMUSG00000051611
AA Change: T161K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.3e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.3e-7 PFAM
Pfam:7tm_1 41 290 8.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173676
Predicted Effect probably benign
Transcript: ENSMUST00000174798
AA Change: T161K

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133654
Gene: ENSMUSG00000051611
AA Change: T161K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 296 3.2e-7 PFAM
Pfam:7tm_1 41 290 8.2e-30 PFAM
Pfam:7tm_4 139 283 1.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208832
AA Change: T161K

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000213274
AA Change: T161K

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Wdcp C A 12: 4,850,617 R158S probably damaging Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Olfr112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Olfr112 APN 17 37563580 missense possibly damaging 0.94
IGL02900:Olfr112 APN 17 37563849 missense possibly damaging 0.72
IGL03352:Olfr112 APN 17 37563790 missense probably damaging 1.00
R0945:Olfr112 UTSW 17 37563387 missense probably benign 0.00
R2475:Olfr112 UTSW 17 37563711 missense probably benign
R4459:Olfr112 UTSW 17 37563474 missense probably damaging 0.99
R4601:Olfr112 UTSW 17 37564185 missense probably damaging 1.00
R6745:Olfr112 UTSW 17 37563579 missense probably damaging 1.00
R7806:Olfr112 UTSW 17 37564221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAGGAGATGACAATCCCAG -3'
(R):5'- AGTTCCCTGGCACAAAGTGG -3'

Sequencing Primer
(F):5'- TGACAATCCCAGTGAAACAGG -3'
(R):5'- GGCTACATTTCATATGCACAGTGC -3'
Posted On2016-06-15