Incidental Mutation 'R5107:Agbl5'
ID393598
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene NameATP/GTP binding protein-like 5
Synonyms
MMRRC Submission 042695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5107 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30888694-30906965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30892478 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 257 (P257Q)
Ref Sequence ENSEMBL: ENSMUSP00000144018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069705] [ENSMUST00000114700] [ENSMUST00000200695] [ENSMUST00000200850] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
Predicted Effect probably damaging
Transcript: ENSMUST00000069705
AA Change: P257Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063228
Gene: ENSMUSG00000029165
AA Change: P257Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 191 361 8.4e-19 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 4e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114700
AA Change: P286Q

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165
AA Change: P286Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134956
AA Change: H282N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148394
AA Change: P767Q
Predicted Effect probably benign
Transcript: ENSMUST00000200695
SMART Domains Protein: ENSMUSP00000144109
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d2ctc__ 148 177 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200850
SMART Domains Protein: ENSMUSP00000144274
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200990
Predicted Effect probably benign
Transcript: ENSMUST00000201014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201167
Predicted Effect probably damaging
Transcript: ENSMUST00000201168
AA Change: P257Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165
AA Change: P257Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201225
AA Change: P257Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165
AA Change: P257Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201523
Predicted Effect probably damaging
Transcript: ENSMUST00000201817
AA Change: P257Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165
AA Change: P257Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201901
Predicted Effect probably damaging
Transcript: ENSMUST00000201917
AA Change: P257Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165
AA Change: P257Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201918
Predicted Effect probably damaging
Transcript: ENSMUST00000202060
AA Change: P257Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165
AA Change: P257Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202893
Meta Mutation Damage Score 0.3701 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T C 13: 60,853,658 N85S possibly damaging Het
Adgre1 A G 17: 57,401,977 Y56C possibly damaging Het
Angptl2 A T 2: 33,228,603 M130L probably damaging Het
Atp6v1f T A 6: 29,468,199 probably null Het
Ccdc78 G A 17: 25,787,480 V133M possibly damaging Het
Clpx A G 9: 65,308,539 K145E possibly damaging Het
Col18a1 T C 10: 77,077,223 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Igkv4-54 T C 6: 69,631,930 I24V possibly damaging Het
Ikzf3 A G 11: 98,490,476 Y93H probably damaging Het
Isl2 T C 9: 55,542,286 V82A probably benign Het
Kcnq2 A T 2: 181,108,547 probably benign Het
Krt4 A T 15: 101,922,791 M225K possibly damaging Het
Ksr2 T C 5: 117,689,608 V484A probably benign Het
Lrba T A 3: 86,359,779 V1592E possibly damaging Het
Lrrc7 G A 3: 158,161,896 P736L probably damaging Het
Mettl8 A T 2: 70,965,557 F376I probably damaging Het
Muc5b T A 7: 141,855,531 H1117Q unknown Het
Myh7 T A 14: 54,986,424 probably benign Het
Myod1 G T 7: 46,377,794 A228S probably benign Het
Ntrk1 T C 3: 87,794,973 T58A probably benign Het
Olfr109 A G 17: 37,466,253 T16A probably damaging Het
Pdcd11 T A 19: 47,106,454 V559E probably damaging Het
Pde10a A G 17: 8,944,970 N191S probably damaging Het
Phf3 A G 1: 30,831,485 S161P probably benign Het
Pias1 C A 9: 62,882,228 A566S probably benign Het
Pik3c2g T C 6: 139,635,625 probably benign Het
Pmp22 A G 11: 63,158,411 E160G probably damaging Het
Polb T C 8: 22,645,046 probably null Het
Prob1 T C 18: 35,652,936 N755S possibly damaging Het
Rhou A T 8: 123,661,173 K215* probably null Het
Scaper A G 9: 55,580,332 S749P probably damaging Het
Selenop A G 15: 3,275,593 E77G probably damaging Het
Sema3a C A 5: 13,577,604 S490* probably null Het
Slc26a2 A G 18: 61,198,560 Y600H probably damaging Het
Slfn8 A C 11: 83,017,150 I189S probably damaging Het
Stab1 T A 14: 31,163,795 probably null Het
Tbc1d13 G A 2: 30,146,721 E205K probably damaging Het
Tex47 C T 5: 7,304,842 R8W probably benign Het
Tmem198b T C 10: 128,802,287 T136A probably benign Het
Trim36 T C 18: 46,172,638 Q414R probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ttn A G 2: 76,778,152 I16063T probably damaging Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Ubox5 A G 2: 130,599,768 L333P probably damaging Het
Vmn2r19 T A 6: 123,309,643 Y78* probably null Het
Wnk4 A G 11: 101,275,538 probably benign Het
Xirp2 A G 2: 67,509,710 D765G probably damaging Het
Xirp2 G T 2: 67,511,861 G1482V probably damaging Het
Znhit1 A G 5: 136,986,828 V2A probably benign Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 30893234 missense probably benign 0.00
sausage UTSW 5 30894358 nonsense probably null
R0355:Agbl5 UTSW 5 30891991 critical splice donor site probably null
R0575:Agbl5 UTSW 5 30894454 missense probably damaging 1.00
R1694:Agbl5 UTSW 5 30893382 missense probably damaging 1.00
R1709:Agbl5 UTSW 5 30906241 missense probably damaging 1.00
R1829:Agbl5 UTSW 5 30903064 missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 30894013 missense probably damaging 0.97
R3418:Agbl5 UTSW 5 30904723 missense probably damaging 1.00
R4827:Agbl5 UTSW 5 30895814 missense probably damaging 1.00
R4828:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R4830:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R5017:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5018:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5036:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5038:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5052:Agbl5 UTSW 5 30891214 missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5073:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5074:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5081:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5083:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5103:Agbl5 UTSW 5 30894001 missense probably damaging 1.00
R5130:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5395:Agbl5 UTSW 5 30890338 missense probably damaging 1.00
R5522:Agbl5 UTSW 5 30893903 unclassified probably null
R5524:Agbl5 UTSW 5 30893903 unclassified probably null
R5526:Agbl5 UTSW 5 30893903 unclassified probably null
R5657:Agbl5 UTSW 5 30894046 missense probably damaging 1.00
R5790:Agbl5 UTSW 5 30894358 nonsense probably null
R6301:Agbl5 UTSW 5 30891833 missense probably damaging 1.00
R6891:Agbl5 UTSW 5 30895178 missense probably damaging 1.00
R6919:Agbl5 UTSW 5 30904717 missense probably benign 0.13
R7388:Agbl5 UTSW 5 30903239 nonsense probably null
R7392:Agbl5 UTSW 5 30890771 critical splice donor site probably null
R7410:Agbl5 UTSW 5 30890688 missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 30893391 missense probably damaging 1.00
R8312:Agbl5 UTSW 5 30894506 missense probably damaging 1.00
RF007:Agbl5 UTSW 5 30903245 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCCAGGGTAGAGGATTAACAATC -3'
(R):5'- CAAACCAGTCAGAAGGCTGG -3'

Sequencing Primer
(F):5'- ACAATCCTGTACCTCTGGTAAACAG -3'
(R):5'- TGACCTGCACAGCCAAGTGAG -3'
Posted On2016-06-15