Mutagenetix > Incidental Mutations

Incidental Mutation 'R5107:Scaper'

393610

Institutional Source

Beutler Lab

Gene Symbol

Scaper

Ensembl Gene

ENSMUSG00000034007

Gene Name

S phase cyclin A-associated protein in the ER

Synonyms

D530014O03Rik, Zfp291

MMRRC Submission

042695-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.573) question?

Stock #

R5107 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55549879-55938119 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55580332 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 749 (S749P)

Ref Sequence

ENSEMBL: ENSMUSP00000149836 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037408
AA Change: S1242P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007
AA Change: S1242P

Domain	Start	End	E-Value	Type
Pfam:SCAPER_N	88	185	3.4e-47	PFAM
low complexity region	323	338	N/A	INTRINSIC
coiled coil region	415	466	N/A	INTRINSIC
coiled coil region	535	597	N/A	INTRINSIC
SCOP:d1eq1a_	605	769	3e-6	SMART
ZnF_C2H2	791	815	1.16e1	SMART
low complexity region	866	883	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214747
AA Change: S1236P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000216595
AA Change: S749P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217647
AA Change: S1242P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.6119

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.7%

Validation Efficiency

98% (56/57)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	T	C	13: 60,853,658	N85S	possibly damaging	Het
Adgre1	A	G	17: 57,401,977	Y56C	possibly damaging	Het
Agbl5	C	A	5: 30,892,478	P257Q	probably damaging	Het
Angptl2	A	T	2: 33,228,603	M130L	probably damaging	Het
Atp6v1f	T	A	6: 29,468,199		probably null	Het
Ccdc78	G	A	17: 25,787,480	V133M	possibly damaging	Het
Clpx	A	G	9: 65,308,539	K145E	possibly damaging	Het
Col18a1	T	C	10: 77,077,223		probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Igkv4-54	T	C	6: 69,631,930	I24V	possibly damaging	Het
Ikzf3	A	G	11: 98,490,476	Y93H	probably damaging	Het
Isl2	T	C	9: 55,542,286	V82A	probably benign	Het
Kcnq2	A	T	2: 181,108,547		probably benign	Het
Krt4	A	T	15: 101,922,791	M225K	possibly damaging	Het
Ksr2	T	C	5: 117,689,608	V484A	probably benign	Het
Lrba	T	A	3: 86,359,779	V1592E	possibly damaging	Het
Lrrc7	G	A	3: 158,161,896	P736L	probably damaging	Het
Mettl8	A	T	2: 70,965,557	F376I	probably damaging	Het
Muc5b	T	A	7: 141,855,531	H1117Q	unknown	Het
Myh7	T	A	14: 54,986,424		probably benign	Het
Myod1	G	T	7: 46,377,794	A228S	probably benign	Het
Ntrk1	T	C	3: 87,794,973	T58A	probably benign	Het
Olfr109	A	G	17: 37,466,253	T16A	probably damaging	Het
Pdcd11	T	A	19: 47,106,454	V559E	probably damaging	Het
Pde10a	A	G	17: 8,944,970	N191S	probably damaging	Het
Phf3	A	G	1: 30,831,485	S161P	probably benign	Het
Pias1	C	A	9: 62,882,228	A566S	probably benign	Het
Pik3c2g	T	C	6: 139,635,625		probably benign	Het
Pmp22	A	G	11: 63,158,411	E160G	probably damaging	Het
Polb	T	C	8: 22,645,046		probably null	Het
Prob1	T	C	18: 35,652,936	N755S	possibly damaging	Het
Rhou	A	T	8: 123,661,173	K215*	probably null	Het
Selenop	A	G	15: 3,275,593	E77G	probably damaging	Het
Sema3a	C	A	5: 13,577,604	S490*	probably null	Het
Slc26a2	A	G	18: 61,198,560	Y600H	probably damaging	Het
Slfn8	A	C	11: 83,017,150	I189S	probably damaging	Het
Stab1	T	A	14: 31,163,795		probably null	Het
Tbc1d13	G	A	2: 30,146,721	E205K	probably damaging	Het
Tex47	C	T	5: 7,304,842	R8W	probably benign	Het
Tmem198b	T	C	10: 128,802,287	T136A	probably benign	Het
Trim36	T	C	18: 46,172,638	Q414R	probably benign	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Ttn	A	G	2: 76,778,152	I16063T	probably damaging	Het
Ttn	A	G	2: 76,863,561	V321A	possibly damaging	Het
Ubox5	A	G	2: 130,599,768	L333P	probably damaging	Het
Vmn2r19	T	A	6: 123,309,643	Y78*	probably null	Het
Wnk4	A	G	11: 101,275,538		probably benign	Het
Xirp2	A	G	2: 67,509,710	D765G	probably damaging	Het
Xirp2	G	T	2: 67,511,861	G1482V	probably damaging	Het
Znhit1	A	G	5: 136,986,828	V2A	probably benign	Het

Other mutations in Scaper

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00653:Scaper	APN	9	55859859	missense	probably damaging	0.99
IGL00912:Scaper	APN	9	55685955	missense	probably damaging	1.00
IGL01469:Scaper	APN	9	55859767	missense	probably damaging	1.00
IGL01626:Scaper	APN	9	55912051	missense	possibly damaging	0.61
IGL01779:Scaper	APN	9	55892240	missense	probably benign	0.20
IGL02011:Scaper	APN	9	55580322	missense	probably damaging	1.00
IGL02997:Scaper	APN	9	55815499	missense	probably damaging	1.00
IGL03107:Scaper	APN	9	55858402	splice site	probably benign
IGL03167:Scaper	APN	9	55859824	missense	probably damaging	1.00
IGL03293:Scaper	APN	9	55874823	missense	probably benign
IGL03340:Scaper	APN	9	55602832	missense	possibly damaging	0.88
IGL03368:Scaper	APN	9	55656027	missense	possibly damaging	0.53
R0111:Scaper	UTSW	9	55602790	missense	probably benign	0.01
R0510:Scaper	UTSW	9	55758062	splice site	probably benign
R0531:Scaper	UTSW	9	55609874	missense	possibly damaging	0.91
R0558:Scaper	UTSW	9	55685923	missense	probably benign	0.08
R0605:Scaper	UTSW	9	55815518	splice site	probably benign
R0646:Scaper	UTSW	9	55758056	missense	probably damaging	1.00
R0837:Scaper	UTSW	9	55859042	nonsense	probably null
R1440:Scaper	UTSW	9	55602918	nonsense	probably null
R1548:Scaper	UTSW	9	55816670	missense	probably damaging	1.00
R1777:Scaper	UTSW	9	55864546	missense	probably benign	0.33
R1822:Scaper	UTSW	9	55859900	missense	probably damaging	0.99
R1834:Scaper	UTSW	9	55816734	missense	possibly damaging	0.90
R1870:Scaper	UTSW	9	55685938	missense	probably damaging	1.00
R2102:Scaper	UTSW	9	55912050	missense	probably benign	0.43
R2168:Scaper	UTSW	9	55743639	missense	probably damaging	1.00
R2174:Scaper	UTSW	9	55859037	missense	probably null	0.01
R3690:Scaper	UTSW	9	55883921	missense	probably benign	0.00
R4392:Scaper	UTSW	9	55858115	missense	probably damaging	0.99
R4418:Scaper	UTSW	9	55838180	missense	probably damaging	1.00
R4606:Scaper	UTSW	9	55655903	critical splice donor site	probably null
R4643:Scaper	UTSW	9	55838179	missense	probably damaging	0.99
R4665:Scaper	UTSW	9	55912055	missense	probably damaging	1.00
R4739:Scaper	UTSW	9	55743648	missense	probably damaging	1.00
R4921:Scaper	UTSW	9	55892235	missense	probably benign	0.02
R4934:Scaper	UTSW	9	55809175	missense	probably damaging	1.00
R4956:Scaper	UTSW	9	55838142	missense	probably damaging	1.00
R5055:Scaper	UTSW	9	55859719	intron	probably null
R5155:Scaper	UTSW	9	55556086	missense	probably null	1.00
R5265:Scaper	UTSW	9	55864546	missense	probably benign
R5408:Scaper	UTSW	9	55586224	missense	probably damaging	0.99
R5623:Scaper	UTSW	9	55864507	missense	probably benign	0.02
R5665:Scaper	UTSW	9	55807632	missense	probably damaging	1.00
R5748:Scaper	UTSW	9	55859076	critical splice acceptor site	probably null
R5771:Scaper	UTSW	9	55816791	missense	probably damaging	1.00
R6534:Scaper	UTSW	9	55883976	missense	probably benign	0.00
R6557:Scaper	UTSW	9	55550850	missense	probably benign	0.02
R6651:Scaper	UTSW	9	55858504	missense	probably benign	0.05
R6796:Scaper	UTSW	9	55864427	missense	probably benign	0.00
R6962:Scaper	UTSW	9	55859771	missense	probably benign	0.01
R7145:Scaper	UTSW	9	55912111	missense	unknown
R7199:Scaper	UTSW	9	55838176	nonsense	probably null
R7356:Scaper	UTSW	9	55892211	missense	unknown
R7426:Scaper	UTSW	9	55762277	nonsense	probably null
R7503:Scaper	UTSW	9	55807754	missense	probably damaging	0.98
X0012:Scaper	UTSW	9	55655930	missense	probably damaging	0.98
X0052:Scaper	UTSW	9	55816664	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATACAGGACAGATGGGTTCCAG -3'
(R):5'- CCAGACTTATGCAAATTTGACATGC -3'

Sequencing Primer
(F):5'- ATGGGTTCCAGCAGGCTAG -3'
(R):5'- CAGGAACTCTGTTATTTAATGCATGC -3'

Posted On

2016-06-15