Incidental Mutation 'R5107:Wnk4'
ID393619
Institutional Source Beutler Lab
Gene Symbol Wnk4
Ensembl Gene ENSMUSG00000035112
Gene NameWNK lysine deficient protein kinase 4
Synonyms2010002J11Rik, Prkwnk4
MMRRC Submission 042695-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R5107 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101260567-101277409 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 101275538 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000017332] [ENSMUST00000103107] [ENSMUST00000103108] [ENSMUST00000139487] [ENSMUST00000147741] [ENSMUST00000168089] [ENSMUST00000170056]
Predicted Effect probably benign
Transcript: ENSMUST00000017332
SMART Domains Protein: ENSMUSP00000017332
Gene: ENSMUSG00000017188

DomainStartEndE-ValueType
Pfam:Coiled-coil_56 1 106 1.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103107
SMART Domains Protein: ENSMUSP00000099396
Gene: ENSMUSG00000078653

DomainStartEndE-ValueType
Pfam:Cyclin_N 111 180 1.8e-6 PFAM
low complexity region 212 221 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000103108
AA Change: T964A
SMART Domains Protein: ENSMUSP00000099397
Gene: ENSMUSG00000035112
AA Change: T964A

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 427 4.7e-42 PFAM
Pfam:Pkinase 171 429 9e-55 PFAM
Pfam:OSR1_C 450 486 3e-18 PFAM
low complexity region 503 513 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 757 778 N/A INTRINSIC
low complexity region 793 808 N/A INTRINSIC
low complexity region 841 877 N/A INTRINSIC
low complexity region 882 915 N/A INTRINSIC
low complexity region 921 951 N/A INTRINSIC
low complexity region 1014 1033 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128735
Predicted Effect probably benign
Transcript: ENSMUST00000139487
SMART Domains Protein: ENSMUSP00000129666
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 242 4e-8 PFAM
Pfam:Pkinase 171 252 1.9e-10 PFAM
low complexity region 269 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147741
SMART Domains Protein: ENSMUSP00000131298
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase 171 394 9.3e-50 PFAM
Pfam:Pkinase_Tyr 171 399 3.7e-38 PFAM
low complexity region 401 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168089
SMART Domains Protein: ENSMUSP00000130367
Gene: ENSMUSG00000017188

DomainStartEndE-ValueType
Pfam:Coiled-coil_56 1 74 2.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170056
SMART Domains Protein: ENSMUSP00000132123
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
Pfam:OSR1_C 13 49 8.6e-20 PFAM
low complexity region 66 76 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170372
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK family of serine-threonine protein kinases. The kinase is part of the tight junction complex in kidney cells, and regulates the balance between NaCl reabsorption and K(+) secretion. The kinase regulates the activities of several types of ion channels, cotransporters, and exchangers involved in electrolyte flux in epithelial cells. Mutations in this gene result in pseudohypoaldosteronism type IIB.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele display increased Na+, K+ and Cl- urinary excretion, alkalosis and decreased plasma Cl-, K+, Mg2+ and renin levels. Mice homozygous for a point mutation exhibit acidosis, hypertension, increased circulating potassium levels and decreased potassium excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T C 13: 60,853,658 N85S possibly damaging Het
Adgre1 A G 17: 57,401,977 Y56C possibly damaging Het
Agbl5 C A 5: 30,892,478 P257Q probably damaging Het
Angptl2 A T 2: 33,228,603 M130L probably damaging Het
Atp6v1f T A 6: 29,468,199 probably null Het
Ccdc78 G A 17: 25,787,480 V133M possibly damaging Het
Clpx A G 9: 65,308,539 K145E possibly damaging Het
Col18a1 T C 10: 77,077,223 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Igkv4-54 T C 6: 69,631,930 I24V possibly damaging Het
Ikzf3 A G 11: 98,490,476 Y93H probably damaging Het
Isl2 T C 9: 55,542,286 V82A probably benign Het
Kcnq2 A T 2: 181,108,547 probably benign Het
Krt4 A T 15: 101,922,791 M225K possibly damaging Het
Ksr2 T C 5: 117,689,608 V484A probably benign Het
Lrba T A 3: 86,359,779 V1592E possibly damaging Het
Lrrc7 G A 3: 158,161,896 P736L probably damaging Het
Mettl8 A T 2: 70,965,557 F376I probably damaging Het
Muc5b T A 7: 141,855,531 H1117Q unknown Het
Myh7 T A 14: 54,986,424 probably benign Het
Myod1 G T 7: 46,377,794 A228S probably benign Het
Ntrk1 T C 3: 87,794,973 T58A probably benign Het
Olfr109 A G 17: 37,466,253 T16A probably damaging Het
Pdcd11 T A 19: 47,106,454 V559E probably damaging Het
Pde10a A G 17: 8,944,970 N191S probably damaging Het
Phf3 A G 1: 30,831,485 S161P probably benign Het
Pias1 C A 9: 62,882,228 A566S probably benign Het
Pik3c2g T C 6: 139,635,625 probably benign Het
Pmp22 A G 11: 63,158,411 E160G probably damaging Het
Polb T C 8: 22,645,046 probably null Het
Prob1 T C 18: 35,652,936 N755S possibly damaging Het
Rhou A T 8: 123,661,173 K215* probably null Het
Scaper A G 9: 55,580,332 S749P probably damaging Het
Selenop A G 15: 3,275,593 E77G probably damaging Het
Sema3a C A 5: 13,577,604 S490* probably null Het
Slc26a2 A G 18: 61,198,560 Y600H probably damaging Het
Slfn8 A C 11: 83,017,150 I189S probably damaging Het
Stab1 T A 14: 31,163,795 probably null Het
Tbc1d13 G A 2: 30,146,721 E205K probably damaging Het
Tex47 C T 5: 7,304,842 R8W probably benign Het
Tmem198b T C 10: 128,802,287 T136A probably benign Het
Trim36 T C 18: 46,172,638 Q414R probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Ttn A G 2: 76,778,152 I16063T probably damaging Het
Ubox5 A G 2: 130,599,768 L333P probably damaging Het
Vmn2r19 T A 6: 123,309,643 Y78* probably null Het
Xirp2 A G 2: 67,509,710 D765G probably damaging Het
Xirp2 G T 2: 67,511,861 G1482V probably damaging Het
Znhit1 A G 5: 136,986,828 V2A probably benign Het
Other mutations in Wnk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wnk4 APN 11 101268748 missense possibly damaging 0.47
IGL00535:Wnk4 APN 11 101264349 missense probably damaging 1.00
IGL01401:Wnk4 APN 11 101276683 splice site probably benign
IGL01931:Wnk4 APN 11 101268484 missense possibly damaging 0.94
IGL01977:Wnk4 APN 11 101265414 missense probably damaging 1.00
IGL02165:Wnk4 APN 11 101275291 unclassified probably benign
IGL02197:Wnk4 APN 11 101263957 missense probably damaging 1.00
IGL02457:Wnk4 APN 11 101269563 splice site probably benign
IGL02963:Wnk4 APN 11 101276213 unclassified probably benign
Caught_dead UTSW 11 101264330 missense probably damaging 1.00
mortification UTSW 11 101263894 makesense probably null
shame UTSW 11 101262856 missense probably damaging 1.00
R0066:Wnk4 UTSW 11 101265435 missense probably damaging 1.00
R0317:Wnk4 UTSW 11 101268804 missense probably benign 0.01
R0628:Wnk4 UTSW 11 101275023 missense probably benign 0.10
R0630:Wnk4 UTSW 11 101265386 missense probably damaging 1.00
R0710:Wnk4 UTSW 11 101274106 missense probably benign 0.22
R1290:Wnk4 UTSW 11 101276340 unclassified probably benign
R1482:Wnk4 UTSW 11 101269636 missense probably damaging 0.99
R1775:Wnk4 UTSW 11 101276340 unclassified probably benign
R2005:Wnk4 UTSW 11 101263890 missense probably damaging 1.00
R2229:Wnk4 UTSW 11 101275641 unclassified probably benign
R2258:Wnk4 UTSW 11 101275035 missense probably damaging 0.98
R2323:Wnk4 UTSW 11 101268481 missense probably damaging 0.99
R3081:Wnk4 UTSW 11 101276891 splice site probably benign
R3763:Wnk4 UTSW 11 101269288 missense probably benign 0.00
R4196:Wnk4 UTSW 11 101269631 missense probably damaging 1.00
R4447:Wnk4 UTSW 11 101268451 missense possibly damaging 0.65
R4614:Wnk4 UTSW 11 101274111 missense probably benign 0.00
R4751:Wnk4 UTSW 11 101276362 unclassified probably benign
R4948:Wnk4 UTSW 11 101268281 missense probably damaging 1.00
R5067:Wnk4 UTSW 11 101262856 missense probably damaging 1.00
R5073:Wnk4 UTSW 11 101261188 missense probably damaging 1.00
R5181:Wnk4 UTSW 11 101265377 missense probably damaging 0.96
R5205:Wnk4 UTSW 11 101265138 missense possibly damaging 0.89
R5252:Wnk4 UTSW 11 101268748 missense possibly damaging 0.47
R5273:Wnk4 UTSW 11 101263869 missense probably damaging 1.00
R5293:Wnk4 UTSW 11 101275197 unclassified probably benign
R5609:Wnk4 UTSW 11 101275636 unclassified probably benign
R5915:Wnk4 UTSW 11 101263894 makesense probably null
R5931:Wnk4 UTSW 11 101261221 missense probably damaging 0.99
R6126:Wnk4 UTSW 11 101276348 unclassified probably benign
R6164:Wnk4 UTSW 11 101275068 missense possibly damaging 0.56
R6191:Wnk4 UTSW 11 101264330 missense probably damaging 1.00
R6267:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R6274:Wnk4 UTSW 11 101265431 missense probably damaging 1.00
R6296:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R7132:Wnk4 UTSW 11 101261200 missense probably benign 0.22
R7251:Wnk4 UTSW 11 101265153 missense possibly damaging 0.70
R7352:Wnk4 UTSW 11 101264418 missense probably damaging 1.00
R7404:Wnk4 UTSW 11 101268492 critical splice donor site probably null
R7624:Wnk4 UTSW 11 101264354 nonsense probably null
R7634:Wnk4 UTSW 11 101262895 missense probably damaging 1.00
R7780:Wnk4 UTSW 11 101269577 missense probably damaging 0.96
R8006:Wnk4 UTSW 11 101268356 missense probably benign 0.00
R8046:Wnk4 UTSW 11 101274092 missense probably benign 0.20
R8143:Wnk4 UTSW 11 101262799 missense probably damaging 1.00
R8458:Wnk4 UTSW 11 101275321 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTATCCCCAAGACCCTCTTAG -3'
(R):5'- TCAAGGGTTAGAGGCCTCAC -3'

Sequencing Primer
(F):5'- AAGACCCTCTTAGCCCCACTTC -3'
(R):5'- CCTTCAGATATAGGTGCCAGTCTAG -3'
Posted On2016-06-15