Incidental Mutation 'R5107:Stab1'
ID 393621
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Name stabilin 1
Synonyms MS-1
MMRRC Submission 042695-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5107 (G1)
Quality Score 197
Status Validated
Chromosome 14
Chromosomal Location 30860970-30890598 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to A at 30885752 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000036618
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159757
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T C 13: 61,001,472 (GRCm39) N85S possibly damaging Het
Adgre1 A G 17: 57,708,977 (GRCm39) Y56C possibly damaging Het
Agbl5 C A 5: 31,049,822 (GRCm39) P257Q probably damaging Het
Angptl2 A T 2: 33,118,615 (GRCm39) M130L probably damaging Het
Atp6v1f T A 6: 29,468,198 (GRCm39) probably null Het
Ccdc78 G A 17: 26,006,454 (GRCm39) V133M possibly damaging Het
Clpx A G 9: 65,215,821 (GRCm39) K145E possibly damaging Het
Col18a1 T C 10: 76,913,057 (GRCm39) probably null Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Igkv4-54 T C 6: 69,608,914 (GRCm39) I24V possibly damaging Het
Ikzf3 A G 11: 98,381,302 (GRCm39) Y93H probably damaging Het
Isl2 T C 9: 55,449,570 (GRCm39) V82A probably benign Het
Kcnq2 A T 2: 180,750,340 (GRCm39) probably benign Het
Krt4 A T 15: 101,831,226 (GRCm39) M225K possibly damaging Het
Ksr2 T C 5: 117,827,673 (GRCm39) V484A probably benign Het
Lrba T A 3: 86,267,086 (GRCm39) V1592E possibly damaging Het
Lrrc7 G A 3: 157,867,533 (GRCm39) P736L probably damaging Het
Mettl8 A T 2: 70,795,901 (GRCm39) F376I probably damaging Het
Muc5b T A 7: 141,409,268 (GRCm39) H1117Q unknown Het
Myh7 T A 14: 55,223,881 (GRCm39) probably benign Het
Myod1 G T 7: 46,027,218 (GRCm39) A228S probably benign Het
Ntrk1 T C 3: 87,702,280 (GRCm39) T58A probably benign Het
Or12d17 A G 17: 37,777,144 (GRCm39) T16A probably damaging Het
Pdcd11 T A 19: 47,094,893 (GRCm39) V559E probably damaging Het
Pde10a A G 17: 9,163,802 (GRCm39) N191S probably damaging Het
Phf3 A G 1: 30,870,566 (GRCm39) S161P probably benign Het
Pias1 C A 9: 62,789,510 (GRCm39) A566S probably benign Het
Pik3c2g T C 6: 139,612,623 (GRCm39) probably benign Het
Pmp22 A G 11: 63,049,237 (GRCm39) E160G probably damaging Het
Polb T C 8: 23,135,062 (GRCm39) probably null Het
Prob1 T C 18: 35,785,989 (GRCm39) N755S possibly damaging Het
Rhou A T 8: 124,387,912 (GRCm39) K215* probably null Het
Scaper A G 9: 55,487,616 (GRCm39) S749P probably damaging Het
Selenop A G 15: 3,305,075 (GRCm39) E77G probably damaging Het
Sema3a C A 5: 13,627,572 (GRCm39) S490* probably null Het
Slc26a2 A G 18: 61,331,632 (GRCm39) Y600H probably damaging Het
Slfn8 A C 11: 82,907,976 (GRCm39) I189S probably damaging Het
Tbc1d13 G A 2: 30,036,733 (GRCm39) E205K probably damaging Het
Tex47 C T 5: 7,354,842 (GRCm39) R8W probably benign Het
Tmem198b T C 10: 128,638,156 (GRCm39) T136A probably benign Het
Trim36 T C 18: 46,305,705 (GRCm39) Q414R probably benign Het
Ttc23l G T 15: 10,551,636 (GRCm39) T30K possibly damaging Het
Ttn A G 2: 76,608,496 (GRCm39) I16063T probably damaging Het
Ttn A G 2: 76,693,905 (GRCm39) V321A possibly damaging Het
Ubox5 A G 2: 130,441,688 (GRCm39) L333P probably damaging Het
Vmn2r19 T A 6: 123,286,602 (GRCm39) Y78* probably null Het
Wnk4 A G 11: 101,166,364 (GRCm39) probably benign Het
Xirp2 A G 2: 67,340,054 (GRCm39) D765G probably damaging Het
Xirp2 G T 2: 67,342,205 (GRCm39) G1482V probably damaging Het
Znhit1 A G 5: 137,015,682 (GRCm39) V2A probably benign Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 30,883,314 (GRCm39) missense probably benign 0.01
IGL00323:Stab1 APN 14 30,861,263 (GRCm39) missense probably benign 0.04
IGL00515:Stab1 APN 14 30,881,686 (GRCm39) missense probably benign 0.20
IGL00844:Stab1 APN 14 30,869,023 (GRCm39) missense probably damaging 1.00
IGL01374:Stab1 APN 14 30,869,032 (GRCm39) missense probably damaging 1.00
IGL01384:Stab1 APN 14 30,872,365 (GRCm39) missense probably benign
IGL01431:Stab1 APN 14 30,870,952 (GRCm39) missense probably benign 0.06
IGL01787:Stab1 APN 14 30,861,765 (GRCm39) missense probably damaging 1.00
IGL02128:Stab1 APN 14 30,872,398 (GRCm39) missense probably damaging 1.00
IGL02138:Stab1 APN 14 30,865,470 (GRCm39) critical splice donor site probably null
IGL02256:Stab1 APN 14 30,863,549 (GRCm39) missense probably damaging 1.00
IGL02340:Stab1 APN 14 30,862,367 (GRCm39) missense probably damaging 0.96
IGL02507:Stab1 APN 14 30,861,167 (GRCm39) unclassified probably benign
IGL02695:Stab1 APN 14 30,881,228 (GRCm39) missense probably damaging 1.00
IGL02755:Stab1 APN 14 30,861,595 (GRCm39) missense probably benign 0.01
IGL02870:Stab1 APN 14 30,861,354 (GRCm39) missense probably benign 0.00
IGL02884:Stab1 APN 14 30,872,100 (GRCm39) splice site probably null
IGL03035:Stab1 APN 14 30,869,726 (GRCm39) missense probably benign 0.00
IGL03267:Stab1 APN 14 30,864,686 (GRCm39) missense probably damaging 1.00
IGL03286:Stab1 APN 14 30,881,283 (GRCm39) splice site probably benign
IGL03366:Stab1 APN 14 30,872,220 (GRCm39) missense possibly damaging 0.58
IGL03412:Stab1 APN 14 30,876,364 (GRCm39) missense probably benign 0.42
R0906_Stab1_335 UTSW 14 30,867,206 (GRCm39) missense probably benign 0.19
R5086_Stab1_467 UTSW 14 30,881,261 (GRCm39) missense probably damaging 1.00
IGL02835:Stab1 UTSW 14 30,867,981 (GRCm39) critical splice donor site probably null
K7371:Stab1 UTSW 14 30,872,206 (GRCm39) missense probably damaging 1.00
R0053:Stab1 UTSW 14 30,862,644 (GRCm39) missense possibly damaging 0.57
R0053:Stab1 UTSW 14 30,862,644 (GRCm39) missense possibly damaging 0.57
R0066:Stab1 UTSW 14 30,879,027 (GRCm39) splice site probably benign
R0066:Stab1 UTSW 14 30,879,027 (GRCm39) splice site probably benign
R0363:Stab1 UTSW 14 30,880,965 (GRCm39) splice site probably benign
R0387:Stab1 UTSW 14 30,870,058 (GRCm39) missense probably benign 0.00
R0391:Stab1 UTSW 14 30,865,375 (GRCm39) missense probably benign 0.21
R0513:Stab1 UTSW 14 30,870,902 (GRCm39) missense probably benign 0.08
R0546:Stab1 UTSW 14 30,861,507 (GRCm39) missense possibly damaging 0.92
R0825:Stab1 UTSW 14 30,874,557 (GRCm39) missense probably benign 0.16
R0906:Stab1 UTSW 14 30,867,206 (GRCm39) missense probably benign 0.19
R0963:Stab1 UTSW 14 30,869,231 (GRCm39) missense probably damaging 0.97
R1219:Stab1 UTSW 14 30,862,578 (GRCm39) splice site probably null
R1234:Stab1 UTSW 14 30,872,193 (GRCm39) missense probably damaging 1.00
R1260:Stab1 UTSW 14 30,873,846 (GRCm39) missense probably damaging 1.00
R1400:Stab1 UTSW 14 30,861,787 (GRCm39) missense possibly damaging 0.92
R1405:Stab1 UTSW 14 30,870,958 (GRCm39) missense probably benign 0.19
R1405:Stab1 UTSW 14 30,870,958 (GRCm39) missense probably benign 0.19
R1440:Stab1 UTSW 14 30,873,647 (GRCm39) nonsense probably null
R1472:Stab1 UTSW 14 30,863,543 (GRCm39) missense probably benign 0.01
R1474:Stab1 UTSW 14 30,871,818 (GRCm39) missense probably benign 0.45
R1475:Stab1 UTSW 14 30,885,785 (GRCm39) missense probably benign
R1509:Stab1 UTSW 14 30,873,541 (GRCm39) splice site probably benign
R1551:Stab1 UTSW 14 30,882,456 (GRCm39) missense probably benign 0.00
R1572:Stab1 UTSW 14 30,872,780 (GRCm39) missense probably damaging 1.00
R1633:Stab1 UTSW 14 30,872,337 (GRCm39) splice site probably null
R1719:Stab1 UTSW 14 30,867,985 (GRCm39) nonsense probably null
R1733:Stab1 UTSW 14 30,867,260 (GRCm39) missense probably damaging 1.00
R1763:Stab1 UTSW 14 30,890,373 (GRCm39) missense probably benign 0.04
R1808:Stab1 UTSW 14 30,863,101 (GRCm39) missense possibly damaging 0.80
R1816:Stab1 UTSW 14 30,879,422 (GRCm39) missense probably benign 0.03
R1853:Stab1 UTSW 14 30,862,420 (GRCm39) missense probably damaging 1.00
R1891:Stab1 UTSW 14 30,863,287 (GRCm39) missense probably benign 0.07
R1984:Stab1 UTSW 14 30,872,605 (GRCm39) missense probably benign 0.20
R1998:Stab1 UTSW 14 30,884,110 (GRCm39) nonsense probably null
R2165:Stab1 UTSW 14 30,890,392 (GRCm39) missense probably benign 0.20
R2191:Stab1 UTSW 14 30,881,227 (GRCm39) missense probably damaging 1.00
R2191:Stab1 UTSW 14 30,864,757 (GRCm39) missense probably benign 0.03
R2233:Stab1 UTSW 14 30,883,837 (GRCm39) missense probably benign 0.08
R2303:Stab1 UTSW 14 30,868,027 (GRCm39) missense probably damaging 1.00
R2496:Stab1 UTSW 14 30,883,420 (GRCm39) missense probably damaging 1.00
R2504:Stab1 UTSW 14 30,884,997 (GRCm39) critical splice donor site probably null
R2519:Stab1 UTSW 14 30,876,829 (GRCm39) missense probably damaging 1.00
R2926:Stab1 UTSW 14 30,883,756 (GRCm39) missense probably damaging 1.00
R4025:Stab1 UTSW 14 30,876,909 (GRCm39) missense possibly damaging 0.46
R4113:Stab1 UTSW 14 30,890,436 (GRCm39) missense probably damaging 0.98
R4258:Stab1 UTSW 14 30,876,629 (GRCm39) missense possibly damaging 0.92
R4588:Stab1 UTSW 14 30,879,402 (GRCm39) missense probably benign 0.01
R4644:Stab1 UTSW 14 30,862,444 (GRCm39) unclassified probably benign
R4660:Stab1 UTSW 14 30,876,872 (GRCm39) missense possibly damaging 0.91
R4801:Stab1 UTSW 14 30,863,328 (GRCm39) nonsense probably null
R4802:Stab1 UTSW 14 30,863,328 (GRCm39) nonsense probably null
R4870:Stab1 UTSW 14 30,864,000 (GRCm39) missense probably benign 0.13
R4872:Stab1 UTSW 14 30,862,350 (GRCm39) missense probably damaging 1.00
R4881:Stab1 UTSW 14 30,865,629 (GRCm39) missense probably benign 0.32
R4941:Stab1 UTSW 14 30,873,528 (GRCm39) missense probably benign 0.00
R5061:Stab1 UTSW 14 30,885,056 (GRCm39) missense probably damaging 1.00
R5086:Stab1 UTSW 14 30,881,261 (GRCm39) missense probably damaging 1.00
R5086:Stab1 UTSW 14 30,865,581 (GRCm39) missense probably damaging 1.00
R5087:Stab1 UTSW 14 30,881,261 (GRCm39) missense probably damaging 1.00
R5092:Stab1 UTSW 14 30,867,812 (GRCm39) missense probably benign 0.01
R5102:Stab1 UTSW 14 30,869,974 (GRCm39) critical splice donor site probably null
R5195:Stab1 UTSW 14 30,862,478 (GRCm39) unclassified probably benign
R5217:Stab1 UTSW 14 30,881,476 (GRCm39) missense probably benign 0.25
R5285:Stab1 UTSW 14 30,865,433 (GRCm39) unclassified probably benign
R5327:Stab1 UTSW 14 30,883,793 (GRCm39) nonsense probably null
R5647:Stab1 UTSW 14 30,879,397 (GRCm39) nonsense probably null
R5696:Stab1 UTSW 14 30,882,178 (GRCm39) missense probably benign
R5996:Stab1 UTSW 14 30,861,508 (GRCm39) missense probably benign 0.39
R6016:Stab1 UTSW 14 30,880,950 (GRCm39) missense probably damaging 1.00
R6017:Stab1 UTSW 14 30,863,501 (GRCm39) missense probably benign 0.00
R6174:Stab1 UTSW 14 30,884,476 (GRCm39) nonsense probably null
R6366:Stab1 UTSW 14 30,863,395 (GRCm39) missense probably benign 0.10
R6754:Stab1 UTSW 14 30,863,038 (GRCm39) missense probably benign
R6788:Stab1 UTSW 14 30,861,117 (GRCm39) missense probably damaging 1.00
R6898:Stab1 UTSW 14 30,880,920 (GRCm39) missense probably benign 0.00
R7124:Stab1 UTSW 14 30,882,824 (GRCm39) missense possibly damaging 0.94
R7145:Stab1 UTSW 14 30,867,030 (GRCm39) critical splice donor site probably null
R7153:Stab1 UTSW 14 30,882,541 (GRCm39) missense probably benign 0.16
R7213:Stab1 UTSW 14 30,865,630 (GRCm39) missense probably benign
R7215:Stab1 UTSW 14 30,882,754 (GRCm39) missense possibly damaging 0.93
R7319:Stab1 UTSW 14 30,862,783 (GRCm39) missense probably damaging 1.00
R7389:Stab1 UTSW 14 30,869,196 (GRCm39) missense probably benign 0.00
R7400:Stab1 UTSW 14 30,879,341 (GRCm39) missense probably null 1.00
R7427:Stab1 UTSW 14 30,881,216 (GRCm39) missense probably benign 0.00
R7428:Stab1 UTSW 14 30,881,216 (GRCm39) missense probably benign 0.00
R7484:Stab1 UTSW 14 30,882,274 (GRCm39) missense probably benign 0.00
R7568:Stab1 UTSW 14 30,874,552 (GRCm39) missense probably damaging 1.00
R7574:Stab1 UTSW 14 30,876,622 (GRCm39) missense probably benign
R7619:Stab1 UTSW 14 30,867,194 (GRCm39) missense probably benign
R7623:Stab1 UTSW 14 30,862,578 (GRCm39) missense probably benign 0.03
R7721:Stab1 UTSW 14 30,863,413 (GRCm39) missense possibly damaging 0.48
R7869:Stab1 UTSW 14 30,876,429 (GRCm39) missense probably benign 0.01
R7936:Stab1 UTSW 14 30,879,372 (GRCm39) missense possibly damaging 0.88
R7956:Stab1 UTSW 14 30,881,981 (GRCm39) missense probably benign 0.02
R7973:Stab1 UTSW 14 30,881,590 (GRCm39) critical splice donor site probably null
R8059:Stab1 UTSW 14 30,882,198 (GRCm39) missense probably benign 0.02
R8116:Stab1 UTSW 14 30,880,910 (GRCm39) missense possibly damaging 0.80
R8304:Stab1 UTSW 14 30,870,911 (GRCm39) missense probably benign 0.14
R8368:Stab1 UTSW 14 30,870,368 (GRCm39) missense possibly damaging 0.91
R8495:Stab1 UTSW 14 30,877,790 (GRCm39) missense probably damaging 1.00
R8513:Stab1 UTSW 14 30,871,747 (GRCm39) critical splice donor site probably null
R8544:Stab1 UTSW 14 30,885,008 (GRCm39) nonsense probably null
R8671:Stab1 UTSW 14 30,879,365 (GRCm39) missense probably damaging 1.00
R8885:Stab1 UTSW 14 30,883,771 (GRCm39) missense possibly damaging 0.79
R8974:Stab1 UTSW 14 30,882,779 (GRCm39) missense probably benign
R9022:Stab1 UTSW 14 30,882,226 (GRCm39) missense probably benign 0.01
R9059:Stab1 UTSW 14 30,876,805 (GRCm39) missense probably benign 0.01
R9226:Stab1 UTSW 14 30,867,812 (GRCm39) missense probably benign 0.00
R9272:Stab1 UTSW 14 30,867,298 (GRCm39) missense probably benign 0.05
R9388:Stab1 UTSW 14 30,876,312 (GRCm39) missense probably damaging 1.00
R9401:Stab1 UTSW 14 30,883,069 (GRCm39) missense probably benign
R9433:Stab1 UTSW 14 30,865,531 (GRCm39) missense probably benign 0.00
R9450:Stab1 UTSW 14 30,884,896 (GRCm39) missense possibly damaging 0.62
R9505:Stab1 UTSW 14 30,877,722 (GRCm39) missense probably damaging 1.00
R9570:Stab1 UTSW 14 30,864,638 (GRCm39) missense probably benign 0.01
R9624:Stab1 UTSW 14 30,863,345 (GRCm39) missense
R9694:Stab1 UTSW 14 30,876,901 (GRCm39) missense probably benign 0.06
R9723:Stab1 UTSW 14 30,885,848 (GRCm39) missense probably benign 0.10
X0026:Stab1 UTSW 14 30,884,148 (GRCm39) missense possibly damaging 0.91
Z1176:Stab1 UTSW 14 30,872,617 (GRCm39) missense probably benign 0.00
Z1176:Stab1 UTSW 14 30,863,995 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAATTCCAGGAATCTACCCATCTC -3'
(R):5'- TATAGACTCAGGCCCCTCACTG -3'

Sequencing Primer
(F):5'- CAGTAGGTGCCTTGTTAAACACC -3'
(R):5'- GTGCATTTTGCCTATGTCCCAGG -3'
Posted On 2016-06-15