Incidental Mutation 'R5107:Pde10a'
ID393627
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission 042695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5107 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8944970 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 191 (N191S)
Ref Sequence ENSEMBL: ENSMUSP00000123216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024647
AA Change: N180S

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: N180S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089085
AA Change: N260S

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: N260S

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115708
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115715
AA Change: N180S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: N180S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect possibly damaging
Transcript: ENSMUST00000115720
AA Change: N243S

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: N243S

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115724
AA Change: N314S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: N314S

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149440
AA Change: N191S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: N191S

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000231430
AA Change: N542S

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T C 13: 60,853,658 N85S possibly damaging Het
Adgre1 A G 17: 57,401,977 Y56C possibly damaging Het
Agbl5 C A 5: 30,892,478 P257Q probably damaging Het
Angptl2 A T 2: 33,228,603 M130L probably damaging Het
Atp6v1f T A 6: 29,468,199 probably null Het
Ccdc78 G A 17: 25,787,480 V133M possibly damaging Het
Clpx A G 9: 65,308,539 K145E possibly damaging Het
Col18a1 T C 10: 77,077,223 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Igkv4-54 T C 6: 69,631,930 I24V possibly damaging Het
Ikzf3 A G 11: 98,490,476 Y93H probably damaging Het
Isl2 T C 9: 55,542,286 V82A probably benign Het
Kcnq2 A T 2: 181,108,547 probably benign Het
Krt4 A T 15: 101,922,791 M225K possibly damaging Het
Ksr2 T C 5: 117,689,608 V484A probably benign Het
Lrba T A 3: 86,359,779 V1592E possibly damaging Het
Lrrc7 G A 3: 158,161,896 P736L probably damaging Het
Mettl8 A T 2: 70,965,557 F376I probably damaging Het
Muc5b T A 7: 141,855,531 H1117Q unknown Het
Myh7 T A 14: 54,986,424 probably benign Het
Myod1 G T 7: 46,377,794 A228S probably benign Het
Ntrk1 T C 3: 87,794,973 T58A probably benign Het
Olfr109 A G 17: 37,466,253 T16A probably damaging Het
Pdcd11 T A 19: 47,106,454 V559E probably damaging Het
Phf3 A G 1: 30,831,485 S161P probably benign Het
Pias1 C A 9: 62,882,228 A566S probably benign Het
Pik3c2g T C 6: 139,635,625 probably benign Het
Pmp22 A G 11: 63,158,411 E160G probably damaging Het
Polb T C 8: 22,645,046 probably null Het
Prob1 T C 18: 35,652,936 N755S possibly damaging Het
Rhou A T 8: 123,661,173 K215* probably null Het
Scaper A G 9: 55,580,332 S749P probably damaging Het
Selenop A G 15: 3,275,593 E77G probably damaging Het
Sema3a C A 5: 13,577,604 S490* probably null Het
Slc26a2 A G 18: 61,198,560 Y600H probably damaging Het
Slfn8 A C 11: 83,017,150 I189S probably damaging Het
Stab1 T A 14: 31,163,795 probably null Het
Tbc1d13 G A 2: 30,146,721 E205K probably damaging Het
Tex47 C T 5: 7,304,842 R8W probably benign Het
Tmem198b T C 10: 128,802,287 T136A probably benign Het
Trim36 T C 18: 46,172,638 Q414R probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ttn A G 2: 76,778,152 I16063T probably damaging Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Ubox5 A G 2: 130,599,768 L333P probably damaging Het
Vmn2r19 T A 6: 123,309,643 Y78* probably null Het
Wnk4 A G 11: 101,275,538 probably benign Het
Xirp2 A G 2: 67,509,710 D765G probably damaging Het
Xirp2 G T 2: 67,511,861 G1482V probably damaging Het
Znhit1 A G 5: 136,986,828 V2A probably benign Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
Bride UTSW 17 8949430 missense possibly damaging 0.60
buzzed UTSW 17 8930537 missense probably damaging 1.00
Gracile UTSW 17 8961920 missense possibly damaging 0.63
nubile UTSW 17 8967462 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
R7833:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R7923:Pde10a UTSW 17 8929132 missense probably benign 0.40
R8053:Pde10a UTSW 17 8974772 missense probably benign 0.12
R8137:Pde10a UTSW 17 8974815 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCCAGATCATAGAGTTGTGC -3'
(R):5'- GCTGGCTGTGGATAAAGATGC -3'

Sequencing Primer
(F):5'- GCCGTTCTCCAGTGAGATAAG -3'
(R):5'- GCAATTCTATAATCCGCATGCG -3'
Posted On2016-06-15