Incidental Mutation 'R5107:Ccdc78'
ID393628
Institutional Source Beutler Lab
Gene Symbol Ccdc78
Ensembl Gene ENSMUSG00000071202
Gene Namecoiled-coil domain containing 78
SynonymsLOC381077, LOC381146
MMRRC Submission 042695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5107 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25786580-25790513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25787480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 133 (V133M)
Ref Sequence ENSEMBL: ENSMUSP00000093155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002350] [ENSMUST00000072735] [ENSMUST00000077938] [ENSMUST00000095500] [ENSMUST00000133071] [ENSMUST00000134108] [ENSMUST00000138759] [ENSMUST00000140738] [ENSMUST00000145053] [ENSMUST00000150324]
Predicted Effect probably benign
Transcript: ENSMUST00000002350
SMART Domains Protein: ENSMUSP00000002350
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 406 8.5e-95 PFAM
Fe_hyd_SSU 410 466 9.56e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072735
SMART Domains Protein: ENSMUSP00000072518
Gene: ENSMUSG00000057411

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1f3la_ 65 141 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077938
SMART Domains Protein: ENSMUSP00000077091
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Pfam:HAGH_C 174 270 3.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095500
AA Change: V133M

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093155
Gene: ENSMUSG00000071202
AA Change: V133M

DomainStartEndE-ValueType
Pfam:DUF4472 63 190 5.5e-23 PFAM
coiled coil region 364 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129917
Predicted Effect probably benign
Transcript: ENSMUST00000133071
SMART Domains Protein: ENSMUSP00000120885
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 1 125 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134108
SMART Domains Protein: ENSMUSP00000117136
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 422 4e-85 PFAM
Fe_hyd_SSU 426 482 9.56e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138100
Predicted Effect probably benign
Transcript: ENSMUST00000138759
SMART Domains Protein: ENSMUSP00000115538
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 1 125 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140738
SMART Domains Protein: ENSMUSP00000116841
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143248
Predicted Effect probably benign
Transcript: ENSMUST00000145053
SMART Domains Protein: ENSMUSP00000114961
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Pfam:Lactamase_B 7 113 3.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149645
Predicted Effect probably benign
Transcript: ENSMUST00000150324
SMART Domains Protein: ENSMUSP00000119647
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Pfam:HAGH_C 174 270 3.2e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene contains two coiled-coil domains. The function of this gene is currently unknown. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T C 13: 60,853,658 N85S possibly damaging Het
Adgre1 A G 17: 57,401,977 Y56C possibly damaging Het
Agbl5 C A 5: 30,892,478 P257Q probably damaging Het
Angptl2 A T 2: 33,228,603 M130L probably damaging Het
Atp6v1f T A 6: 29,468,199 probably null Het
Clpx A G 9: 65,308,539 K145E possibly damaging Het
Col18a1 T C 10: 77,077,223 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Igkv4-54 T C 6: 69,631,930 I24V possibly damaging Het
Ikzf3 A G 11: 98,490,476 Y93H probably damaging Het
Isl2 T C 9: 55,542,286 V82A probably benign Het
Kcnq2 A T 2: 181,108,547 probably benign Het
Krt4 A T 15: 101,922,791 M225K possibly damaging Het
Ksr2 T C 5: 117,689,608 V484A probably benign Het
Lrba T A 3: 86,359,779 V1592E possibly damaging Het
Lrrc7 G A 3: 158,161,896 P736L probably damaging Het
Mettl8 A T 2: 70,965,557 F376I probably damaging Het
Muc5b T A 7: 141,855,531 H1117Q unknown Het
Myh7 T A 14: 54,986,424 probably benign Het
Myod1 G T 7: 46,377,794 A228S probably benign Het
Ntrk1 T C 3: 87,794,973 T58A probably benign Het
Olfr109 A G 17: 37,466,253 T16A probably damaging Het
Pdcd11 T A 19: 47,106,454 V559E probably damaging Het
Pde10a A G 17: 8,944,970 N191S probably damaging Het
Phf3 A G 1: 30,831,485 S161P probably benign Het
Pias1 C A 9: 62,882,228 A566S probably benign Het
Pik3c2g T C 6: 139,635,625 probably benign Het
Pmp22 A G 11: 63,158,411 E160G probably damaging Het
Polb T C 8: 22,645,046 probably null Het
Prob1 T C 18: 35,652,936 N755S possibly damaging Het
Rhou A T 8: 123,661,173 K215* probably null Het
Scaper A G 9: 55,580,332 S749P probably damaging Het
Selenop A G 15: 3,275,593 E77G probably damaging Het
Sema3a C A 5: 13,577,604 S490* probably null Het
Slc26a2 A G 18: 61,198,560 Y600H probably damaging Het
Slfn8 A C 11: 83,017,150 I189S probably damaging Het
Stab1 T A 14: 31,163,795 probably null Het
Tbc1d13 G A 2: 30,146,721 E205K probably damaging Het
Tex47 C T 5: 7,304,842 R8W probably benign Het
Tmem198b T C 10: 128,802,287 T136A probably benign Het
Trim36 T C 18: 46,172,638 Q414R probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ttn A G 2: 76,778,152 I16063T probably damaging Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Ubox5 A G 2: 130,599,768 L333P probably damaging Het
Vmn2r19 T A 6: 123,309,643 Y78* probably null Het
Wnk4 A G 11: 101,275,538 probably benign Het
Xirp2 A G 2: 67,509,710 D765G probably damaging Het
Xirp2 G T 2: 67,511,861 G1482V probably damaging Het
Znhit1 A G 5: 136,986,828 V2A probably benign Het
Other mutations in Ccdc78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc78 APN 17 25789054 missense possibly damaging 0.73
IGL01060:Ccdc78 APN 17 25788832 missense probably damaging 1.00
IGL01403:Ccdc78 APN 17 25788244 critical splice donor site probably null
R0201:Ccdc78 UTSW 17 25789236 unclassified probably benign
R1521:Ccdc78 UTSW 17 25788781 missense probably damaging 1.00
R1933:Ccdc78 UTSW 17 25787070 missense probably damaging 1.00
R4860:Ccdc78 UTSW 17 25788700 missense probably benign
R4860:Ccdc78 UTSW 17 25788700 missense probably benign
R5195:Ccdc78 UTSW 17 25789988 splice site probably null
R5587:Ccdc78 UTSW 17 25786677 missense probably benign 0.27
R6145:Ccdc78 UTSW 17 25789065 missense probably benign 0.09
R6392:Ccdc78 UTSW 17 25788174 missense probably damaging 0.97
R7624:Ccdc78 UTSW 17 25787152 missense probably damaging 1.00
R7654:Ccdc78 UTSW 17 25790111 missense probably damaging 1.00
R7956:Ccdc78 UTSW 17 25787117 missense possibly damaging 0.92
X0028:Ccdc78 UTSW 17 25789855 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGCATGTGTCCAGGTGAGTATC -3'
(R):5'- TGTGCATTGACGATCTTCATGC -3'

Sequencing Primer
(F):5'- CAGGTGAGTATCTACTTGCTCCAG -3'
(R):5'- GACGATCTTCATGCTGCTCAGG -3'
Posted On2016-06-15