Incidental Mutation 'R5107:Olfr109'
ID393629
Institutional Source Beutler Lab
Gene Symbol Olfr109
Ensembl Gene ENSMUSG00000029184
Gene Nameolfactory receptor 109
SynonymsGA_x6K02T2PSCP-1914078-1915022, MOR250-1
MMRRC Submission 042695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5107 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37458916-37471590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37466253 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 16 (T16A)
Ref Sequence ENSEMBL: ENSMUSP00000150044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031086] [ENSMUST00000214668] [ENSMUST00000214938] [ENSMUST00000217602]
Predicted Effect probably damaging
Transcript: ENSMUST00000031086
AA Change: T16A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031086
Gene: ENSMUSG00000029184
AA Change: T16A

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 3.4e-54 PFAM
Pfam:7tm_1 39 291 6.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214668
AA Change: T16A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214938
AA Change: T16A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217602
AA Change: T16A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.2411 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T C 13: 60,853,658 N85S possibly damaging Het
Adgre1 A G 17: 57,401,977 Y56C possibly damaging Het
Agbl5 C A 5: 30,892,478 P257Q probably damaging Het
Angptl2 A T 2: 33,228,603 M130L probably damaging Het
Atp6v1f T A 6: 29,468,199 probably null Het
Ccdc78 G A 17: 25,787,480 V133M possibly damaging Het
Clpx A G 9: 65,308,539 K145E possibly damaging Het
Col18a1 T C 10: 77,077,223 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Igkv4-54 T C 6: 69,631,930 I24V possibly damaging Het
Ikzf3 A G 11: 98,490,476 Y93H probably damaging Het
Isl2 T C 9: 55,542,286 V82A probably benign Het
Kcnq2 A T 2: 181,108,547 probably benign Het
Krt4 A T 15: 101,922,791 M225K possibly damaging Het
Ksr2 T C 5: 117,689,608 V484A probably benign Het
Lrba T A 3: 86,359,779 V1592E possibly damaging Het
Lrrc7 G A 3: 158,161,896 P736L probably damaging Het
Mettl8 A T 2: 70,965,557 F376I probably damaging Het
Muc5b T A 7: 141,855,531 H1117Q unknown Het
Myh7 T A 14: 54,986,424 probably benign Het
Myod1 G T 7: 46,377,794 A228S probably benign Het
Ntrk1 T C 3: 87,794,973 T58A probably benign Het
Pdcd11 T A 19: 47,106,454 V559E probably damaging Het
Pde10a A G 17: 8,944,970 N191S probably damaging Het
Phf3 A G 1: 30,831,485 S161P probably benign Het
Pias1 C A 9: 62,882,228 A566S probably benign Het
Pik3c2g T C 6: 139,635,625 probably benign Het
Pmp22 A G 11: 63,158,411 E160G probably damaging Het
Polb T C 8: 22,645,046 probably null Het
Prob1 T C 18: 35,652,936 N755S possibly damaging Het
Rhou A T 8: 123,661,173 K215* probably null Het
Scaper A G 9: 55,580,332 S749P probably damaging Het
Selenop A G 15: 3,275,593 E77G probably damaging Het
Sema3a C A 5: 13,577,604 S490* probably null Het
Slc26a2 A G 18: 61,198,560 Y600H probably damaging Het
Slfn8 A C 11: 83,017,150 I189S probably damaging Het
Stab1 T A 14: 31,163,795 probably null Het
Tbc1d13 G A 2: 30,146,721 E205K probably damaging Het
Tex47 C T 5: 7,304,842 R8W probably benign Het
Tmem198b T C 10: 128,802,287 T136A probably benign Het
Trim36 T C 18: 46,172,638 Q414R probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ttn A G 2: 76,778,152 I16063T probably damaging Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Ubox5 A G 2: 130,599,768 L333P probably damaging Het
Vmn2r19 T A 6: 123,309,643 Y78* probably null Het
Wnk4 A G 11: 101,275,538 probably benign Het
Xirp2 A G 2: 67,509,710 D765G probably damaging Het
Xirp2 G T 2: 67,511,861 G1482V probably damaging Het
Znhit1 A G 5: 136,986,828 V2A probably benign Het
Other mutations in Olfr109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Olfr109 APN 17 37466758 missense probably damaging 1.00
IGL02039:Olfr109 APN 17 37466449 missense possibly damaging 0.49
IGL02391:Olfr109 APN 17 37466586 missense probably damaging 1.00
IGL02730:Olfr109 APN 17 37466859 missense probably damaging 1.00
IGL02751:Olfr109 APN 17 37466415 missense probably damaging 0.98
IGL02891:Olfr109 APN 17 37466944 missense probably damaging 1.00
IGL03023:Olfr109 APN 17 37466994 missense probably benign
IGL03343:Olfr109 APN 17 37466409 missense probably damaging 1.00
R0026:Olfr109 UTSW 17 37466803 missense probably damaging 0.99
R0579:Olfr109 UTSW 17 37466347 missense probably benign 0.01
R1751:Olfr109 UTSW 17 37466901 missense probably benign 0.00
R1848:Olfr109 UTSW 17 37467047 missense probably damaging 0.99
R2392:Olfr109 UTSW 17 37466419 missense probably damaging 1.00
R4249:Olfr109 UTSW 17 37466824 missense probably damaging 0.98
R4464:Olfr109 UTSW 17 37466851 missense probably damaging 1.00
R4857:Olfr109 UTSW 17 37466823 missense possibly damaging 0.80
R4947:Olfr109 UTSW 17 37466743 missense probably damaging 1.00
R5526:Olfr109 UTSW 17 37467112 missense unknown
R6147:Olfr109 UTSW 17 37466539 missense probably benign 0.00
R6416:Olfr109 UTSW 17 37467080 nonsense probably null
R7450:Olfr109 UTSW 17 37466616 missense probably benign 0.00
R7487:Olfr109 UTSW 17 37466566 missense probably damaging 0.96
R7822:Olfr109 UTSW 17 37467103 missense probably benign 0.00
R8041:Olfr109 UTSW 17 37466649 missense probably benign
R8051:Olfr109 UTSW 17 37466322 missense probably damaging 1.00
X0063:Olfr109 UTSW 17 37466524 missense probably damaging 1.00
X0065:Olfr109 UTSW 17 37466318 missense probably damaging 1.00
Z1176:Olfr109 UTSW 17 37466661 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGAAGCTCACCCTAAGTTCCTC -3'
(R):5'- GGAATGATATGGCCCTACGC -3'

Sequencing Primer
(F):5'- CTAAGTTCCTCCATAGAGTCATGTG -3'
(R):5'- CTACGCCTCGAGAGAAGGTTG -3'
Posted On2016-06-15