Incidental Mutation 'R5107:Adgre1'
ID393630
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Nameadhesion G protein-coupled receptor E1
SynonymsEmr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
MMRRC Submission 042695-MU
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R5107 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location57358686-57483529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57401977 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 56 (Y56C)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004850
AA Change: Y56C

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: Y56C

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000086763
AA Change: Y56C

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: Y56C

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Meta Mutation Damage Score 0.1667 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (56/57)
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T C 13: 60,853,658 N85S possibly damaging Het
Agbl5 C A 5: 30,892,478 P257Q probably damaging Het
Angptl2 A T 2: 33,228,603 M130L probably damaging Het
Atp6v1f T A 6: 29,468,199 probably null Het
Ccdc78 G A 17: 25,787,480 V133M possibly damaging Het
Clpx A G 9: 65,308,539 K145E possibly damaging Het
Col18a1 T C 10: 77,077,223 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Igkv4-54 T C 6: 69,631,930 I24V possibly damaging Het
Ikzf3 A G 11: 98,490,476 Y93H probably damaging Het
Isl2 T C 9: 55,542,286 V82A probably benign Het
Kcnq2 A T 2: 181,108,547 probably benign Het
Krt4 A T 15: 101,922,791 M225K possibly damaging Het
Ksr2 T C 5: 117,689,608 V484A probably benign Het
Lrba T A 3: 86,359,779 V1592E possibly damaging Het
Lrrc7 G A 3: 158,161,896 P736L probably damaging Het
Mettl8 A T 2: 70,965,557 F376I probably damaging Het
Muc5b T A 7: 141,855,531 H1117Q unknown Het
Myh7 T A 14: 54,986,424 probably benign Het
Myod1 G T 7: 46,377,794 A228S probably benign Het
Ntrk1 T C 3: 87,794,973 T58A probably benign Het
Olfr109 A G 17: 37,466,253 T16A probably damaging Het
Pdcd11 T A 19: 47,106,454 V559E probably damaging Het
Pde10a A G 17: 8,944,970 N191S probably damaging Het
Phf3 A G 1: 30,831,485 S161P probably benign Het
Pias1 C A 9: 62,882,228 A566S probably benign Het
Pik3c2g T C 6: 139,635,625 probably benign Het
Pmp22 A G 11: 63,158,411 E160G probably damaging Het
Polb T C 8: 22,645,046 probably null Het
Prob1 T C 18: 35,652,936 N755S possibly damaging Het
Rhou A T 8: 123,661,173 K215* probably null Het
Scaper A G 9: 55,580,332 S749P probably damaging Het
Selenop A G 15: 3,275,593 E77G probably damaging Het
Sema3a C A 5: 13,577,604 S490* probably null Het
Slc26a2 A G 18: 61,198,560 Y600H probably damaging Het
Slfn8 A C 11: 83,017,150 I189S probably damaging Het
Stab1 T A 14: 31,163,795 probably null Het
Tbc1d13 G A 2: 30,146,721 E205K probably damaging Het
Tex47 C T 5: 7,304,842 R8W probably benign Het
Tmem198b T C 10: 128,802,287 T136A probably benign Het
Trim36 T C 18: 46,172,638 Q414R probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ttn A G 2: 76,778,152 I16063T probably damaging Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Ubox5 A G 2: 130,599,768 L333P probably damaging Het
Vmn2r19 T A 6: 123,309,643 Y78* probably null Het
Wnk4 A G 11: 101,275,538 probably benign Het
Xirp2 A G 2: 67,509,710 D765G probably damaging Het
Xirp2 G T 2: 67,511,861 G1482V probably damaging Het
Znhit1 A G 5: 136,986,828 V2A probably benign Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57402519 missense unknown
R7939:Adgre1 UTSW 17 57449938 missense probably damaging 0.98
R7977:Adgre1 UTSW 17 57447987 missense possibly damaging 0.54
R7987:Adgre1 UTSW 17 57447987 missense possibly damaging 0.54
R8187:Adgre1 UTSW 17 57420349 missense probably benign 0.00
R8210:Adgre1 UTSW 17 57445061 missense possibly damaging 0.94
R8223:Adgre1 UTSW 17 57361692 missense probably damaging 0.99
R8344:Adgre1 UTSW 17 57408459 missense probably benign 0.12
Z1176:Adgre1 UTSW 17 57361729 missense possibly damaging 0.76
Z1177:Adgre1 UTSW 17 57419374 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTCATAGGCAGGAGACTCTAGG -3'
(R):5'- CAGATTCACAAGGTTCCTTCCC -3'

Sequencing Primer
(F):5'- AGACTCTAGGGTGTGACTCCTC -3'
(R):5'- AAGGTTCCTTCCCTTGGACATATG -3'
Posted On2016-06-15