Incidental Mutation 'R5108:Ubr1'
ID393647
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Nameubiquitin protein ligase E3 component n-recognin 1
SynonymsE3 alpha
MMRRC Submission 042696-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.836) question?
Stock #R5108 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120860269-120970715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120963422 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 94 (G94R)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
Predicted Effect probably benign
Transcript: ENSMUST00000028728
AA Change: G94R

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: G94R

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138824
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,094,208 N94Y probably damaging Het
Ak2 A G 4: 129,002,241 T104A probably damaging Het
Alox12b G T 11: 69,157,382 A46S probably benign Het
Ank1 G T 8: 23,132,555 V1662F probably benign Het
Anxa3 T C 5: 96,830,414 I219T possibly damaging Het
Arhgap40 G A 2: 158,547,679 V588M probably damaging Het
Arhgef38 T C 3: 133,137,268 T514A probably benign Het
Ascl4 C A 10: 85,928,558 A23E probably benign Het
Bcl11b T C 12: 107,965,726 T196A probably benign Het
C1ra A T 6: 124,522,922 Y689F probably damaging Het
Ccr3 A G 9: 124,028,931 N101S probably benign Het
Cep70 A T 9: 99,263,812 probably null Het
Ces1b A G 8: 93,071,913 V215A probably damaging Het
Cndp1 A T 18: 84,632,061 I169N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo2 A G 4: 148,166,029 Q275R probably damaging Het
Fbxo44 T C 4: 148,158,563 N133S probably damaging Het
Fzr1 C T 10: 81,369,450 probably benign Het
Gm4778 C T 3: 94,265,835 S50L probably damaging Het
Grn T C 11: 102,434,402 S213P probably benign Het
Ifi203 A T 1: 173,924,014 C414S probably damaging Het
Igfn1 C T 1: 135,982,441 R135H probably benign Het
Kcnk10 T C 12: 98,435,301 M358V probably benign Het
Kcnn2 A T 18: 45,592,055 Y471F probably damaging Het
Klhl20 A T 1: 161,099,250 V391E probably damaging Het
Krt2 C T 15: 101,813,286 G440D possibly damaging Het
Lpin1 A T 12: 16,573,715 Y223N probably benign Het
Luzp2 G A 7: 55,265,290 C321Y probably damaging Het
Mcm3ap T C 10: 76,502,702 V1388A probably benign Het
Mdga2 A T 12: 66,486,741 H223Q probably benign Het
Mgat4e G T 1: 134,541,223 P361Q probably benign Het
Mylk3 A T 8: 85,359,092 I208N possibly damaging Het
Myom2 T A 8: 15,132,667 V1368E probably damaging Het
Mypn C T 10: 63,136,294 D656N probably damaging Het
Nat10 C A 2: 103,732,203 R596L probably damaging Het
Nek8 T C 11: 78,172,527 D137G probably damaging Het
Neurl1a A G 19: 47,257,635 K552E probably damaging Het
Npdc1 C T 2: 25,408,655 H260Y probably damaging Het
Nuggc A T 14: 65,638,680 I581F probably damaging Het
Olfr930 T A 9: 38,930,855 I228N probably damaging Het
P2rx6 T C 16: 17,562,173 Y54H probably damaging Het
Pcmtd2 A G 2: 181,844,423 E112G probably damaging Het
Pcnx4 G A 12: 72,574,081 V892I probably benign Het
Pdss1 T A 2: 22,906,883 V136E possibly damaging Het
Pias3 T C 3: 96,704,937 L561P possibly damaging Het
Pomgnt1 G A 4: 116,156,256 probably benign Het
Scn2a C T 2: 65,688,630 T400I probably damaging Het
Sec24d T A 3: 123,305,785 probably null Het
Sftpb T G 6: 72,304,656 L11R probably damaging Het
Slc22a19 A G 19: 7,711,171 I8T probably benign Het
Slc22a30 A G 19: 8,386,426 S266P probably damaging Het
Slc36a2 C A 11: 55,159,388 G465W probably damaging Het
Slc4a2 G A 5: 24,439,333 M976I probably damaging Het
Smcr8 C T 11: 60,779,870 Q615* probably null Het
Sobp T C 10: 43,160,819 E41G probably damaging Het
Spz1 A T 13: 92,575,046 C307* probably null Het
Sult1d1 C T 5: 87,563,869 probably null Het
Svs1 C T 6: 48,988,570 T504I probably damaging Het
Tas2r110 T C 6: 132,868,705 M233T probably damaging Het
Tmc3 C A 7: 83,619,948 S781R probably damaging Het
Tmem234 G T 4: 129,601,937 probably benign Het
Trpm3 A T 19: 22,904,714 Q645L probably benign Het
Ttn C A 2: 76,734,711 V28391F probably damaging Het
Txnrd3 G T 6: 89,673,034 A425S probably benign Het
Ufl1 A G 4: 25,269,026 probably null Het
Utp20 T C 10: 88,768,873 D1720G probably benign Het
Vmn1r13 T A 6: 57,209,916 M20K probably benign Het
Vmn1r61 A G 7: 5,610,520 I265T probably benign Het
Zfp120 T C 2: 150,119,942 T29A probably damaging Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 splice site probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 splice site probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7519:Ubr1 UTSW 2 120875444 missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120873191 missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120934374 missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120934417 nonsense probably null
R8221:Ubr1 UTSW 2 120961104 missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120963456 missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120911115 missense probably benign
R8293:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R8420:Ubr1 UTSW 2 120870995 missense probably benign
R8489:Ubr1 UTSW 2 120881067 missense probably benign 0.42
R8708:Ubr1 UTSW 2 120866483 missense probably benign 0.27
R8856:Ubr1 UTSW 2 120904042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGCTTAATAAGGAGCCG -3'
(R):5'- GTGGGATCAGCAAGTTGATTTC -3'

Sequencing Primer
(F):5'- AGGAGCCGTATATTAAAAATCAAGC -3'
(R):5'- GGGATCAGCAAGTTGATTTCTATAC -3'
Posted On2016-06-15