Mutagenetix > Incidental Mutations

Incidental Mutation 'R5108:Sec24d'

393653

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

MMRRC Submission

042696-MU

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5108 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 123305785 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

Predicted Effect

probably null
Transcript: ENSMUST00000047923

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197291

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	A	6: 23,094,208	N94Y	probably damaging	Het
Ak2	A	G	4: 129,002,241	T104A	probably damaging	Het
Alox12b	G	T	11: 69,157,382	A46S	probably benign	Het
Ank1	G	T	8: 23,132,555	V1662F	probably benign	Het
Anxa3	T	C	5: 96,830,414	I219T	possibly damaging	Het
Arhgap40	G	A	2: 158,547,679	V588M	probably damaging	Het
Arhgef38	T	C	3: 133,137,268	T514A	probably benign	Het
Ascl4	C	A	10: 85,928,558	A23E	probably benign	Het
Bcl11b	T	C	12: 107,965,726	T196A	probably benign	Het
C1ra	A	T	6: 124,522,922	Y689F	probably damaging	Het
Ccr3	A	G	9: 124,028,931	N101S	probably benign	Het
Cep70	A	T	9: 99,263,812		probably null	Het
Ces1b	A	G	8: 93,071,913	V215A	probably damaging	Het
Cndp1	A	T	18: 84,632,061	I169N	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Fbxo2	A	G	4: 148,166,029	Q275R	probably damaging	Het
Fbxo44	T	C	4: 148,158,563	N133S	probably damaging	Het
Fzr1	C	T	10: 81,369,450		probably benign	Het
Gm4778	C	T	3: 94,265,835	S50L	probably damaging	Het
Grn	T	C	11: 102,434,402	S213P	probably benign	Het
Ifi203	A	T	1: 173,924,014	C414S	probably damaging	Het
Igfn1	C	T	1: 135,982,441	R135H	probably benign	Het
Kcnk10	T	C	12: 98,435,301	M358V	probably benign	Het
Kcnn2	A	T	18: 45,592,055	Y471F	probably damaging	Het
Klhl20	A	T	1: 161,099,250	V391E	probably damaging	Het
Krt2	C	T	15: 101,813,286	G440D	possibly damaging	Het
Lpin1	A	T	12: 16,573,715	Y223N	probably benign	Het
Luzp2	G	A	7: 55,265,290	C321Y	probably damaging	Het
Mcm3ap	T	C	10: 76,502,702	V1388A	probably benign	Het
Mdga2	A	T	12: 66,486,741	H223Q	probably benign	Het
Mgat4e	G	T	1: 134,541,223	P361Q	probably benign	Het
Mylk3	A	T	8: 85,359,092	I208N	possibly damaging	Het
Myom2	T	A	8: 15,132,667	V1368E	probably damaging	Het
Mypn	C	T	10: 63,136,294	D656N	probably damaging	Het
Nat10	C	A	2: 103,732,203	R596L	probably damaging	Het
Nek8	T	C	11: 78,172,527	D137G	probably damaging	Het
Neurl1a	A	G	19: 47,257,635	K552E	probably damaging	Het
Npdc1	C	T	2: 25,408,655	H260Y	probably damaging	Het
Nuggc	A	T	14: 65,638,680	I581F	probably damaging	Het
Olfr930	T	A	9: 38,930,855	I228N	probably damaging	Het
P2rx6	T	C	16: 17,562,173	Y54H	probably damaging	Het
Pcmtd2	A	G	2: 181,844,423	E112G	probably damaging	Het
Pcnx4	G	A	12: 72,574,081	V892I	probably benign	Het
Pdss1	T	A	2: 22,906,883	V136E	possibly damaging	Het
Pias3	T	C	3: 96,704,937	L561P	possibly damaging	Het
Pomgnt1	G	A	4: 116,156,256		probably benign	Het
Scn2a	C	T	2: 65,688,630	T400I	probably damaging	Het
Sftpb	T	G	6: 72,304,656	L11R	probably damaging	Het
Slc22a19	A	G	19: 7,711,171	I8T	probably benign	Het
Slc22a30	A	G	19: 8,386,426	S266P	probably damaging	Het
Slc36a2	C	A	11: 55,159,388	G465W	probably damaging	Het
Slc4a2	G	A	5: 24,439,333	M976I	probably damaging	Het
Smcr8	C	T	11: 60,779,870	Q615*	probably null	Het
Sobp	T	C	10: 43,160,819	E41G	probably damaging	Het
Spz1	A	T	13: 92,575,046	C307*	probably null	Het
Sult1d1	C	T	5: 87,563,869		probably null	Het
Svs1	C	T	6: 48,988,570	T504I	probably damaging	Het
Tas2r110	T	C	6: 132,868,705	M233T	probably damaging	Het
Tmc3	C	A	7: 83,619,948	S781R	probably damaging	Het
Tmem234	G	T	4: 129,601,937		probably benign	Het
Trpm3	A	T	19: 22,904,714	Q645L	probably benign	Het
Ttn	C	A	2: 76,734,711	V28391F	probably damaging	Het
Txnrd3	G	T	6: 89,673,034	A425S	probably benign	Het
Ubr1	C	T	2: 120,963,422	G94R	probably benign	Het
Ufl1	A	G	4: 25,269,026		probably null	Het
Utp20	T	C	10: 88,768,873	D1720G	probably benign	Het
Vmn1r13	T	A	6: 57,209,916	M20K	probably benign	Het
Vmn1r61	A	G	7: 5,610,520	I265T	probably benign	Het
Zfp120	T	C	2: 150,119,942	T29A	probably damaging	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0008:Sec24d	UTSW	3	123350876	splice site	probably benign
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1775:Sec24d	UTSW	3	123336517	missense	probably damaging	1.00
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R1946:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2504:Sec24d	UTSW	3	123353606	missense	possibly damaging	0.69
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R4982:Sec24d	UTSW	3	123299606	missense	probably benign	0.29
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5078:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343085	missense	probably damaging	1.00
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5775:Sec24d	UTSW	3	123290460	missense	probably benign	0.00
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00
R8270:Sec24d	UTSW	3	123305886	missense	possibly damaging	0.90
R8481:Sec24d	UTSW	3	123353424	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGTCTTGCGCATGTCCCTG -3'
(R):5'- ACTTTCCTGGAGTTTGGCATAAC -3'

Sequencing Primer
(F):5'- CATGTCCCTGGAGTGTAGATCAC -3'
(R):5'- CCTGTCGAGGCCATTTTGGAG -3'

Posted On

2016-06-15