Incidental Mutation 'R5108:Anxa3'
ID393662
Institutional Source Beutler Lab
Gene Symbol Anxa3
Ensembl Gene ENSMUSG00000029484
Gene Nameannexin A3
SynonymsAnx3
MMRRC Submission 042696-MU
Accession Numbers

Genbank: NM_013470; MGI: 1201378; Ensembl: ENSMUST00000112985

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5108 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location96793339-96845966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96830414 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 219 (I219T)
Ref Sequence ENSEMBL: ENSMUSP00000031447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031447] [ENSMUST00000198631]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031447
AA Change: I219T

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031447
Gene: ENSMUSG00000029484
AA Change: I219T

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
ANX 191 243 3.67e-22 SMART
ANX 266 318 2.87e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197339
Predicted Effect probably benign
Transcript: ENSMUST00000198631
SMART Domains Protein: ENSMUSP00000143491
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199656
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions in the inhibition of phopholipase A2 and cleavage of inositol 1,2-cyclic phosphate to form inositol 1-phosphate. This protein may also play a role in anti-coagulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,094,208 N94Y probably damaging Het
Ak2 A G 4: 129,002,241 T104A probably damaging Het
Alox12b G T 11: 69,157,382 A46S probably benign Het
Ank1 G T 8: 23,132,555 V1662F probably benign Het
Arhgap40 G A 2: 158,547,679 V588M probably damaging Het
Arhgef38 T C 3: 133,137,268 T514A probably benign Het
Ascl4 C A 10: 85,928,558 A23E probably benign Het
Bcl11b T C 12: 107,965,726 T196A probably benign Het
C1ra A T 6: 124,522,922 Y689F probably damaging Het
Ccr3 A G 9: 124,028,931 N101S probably benign Het
Cep70 A T 9: 99,263,812 probably null Het
Ces1b A G 8: 93,071,913 V215A probably damaging Het
Cndp1 A T 18: 84,632,061 I169N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo2 A G 4: 148,166,029 Q275R probably damaging Het
Fbxo44 T C 4: 148,158,563 N133S probably damaging Het
Fzr1 C T 10: 81,369,450 probably benign Het
Gm4778 C T 3: 94,265,835 S50L probably damaging Het
Grn T C 11: 102,434,402 S213P probably benign Het
Ifi203 A T 1: 173,924,014 C414S probably damaging Het
Igfn1 C T 1: 135,982,441 R135H probably benign Het
Kcnk10 T C 12: 98,435,301 M358V probably benign Het
Kcnn2 A T 18: 45,592,055 Y471F probably damaging Het
Klhl20 A T 1: 161,099,250 V391E probably damaging Het
Krt2 C T 15: 101,813,286 G440D possibly damaging Het
Lpin1 A T 12: 16,573,715 Y223N probably benign Het
Luzp2 G A 7: 55,265,290 C321Y probably damaging Het
Mcm3ap T C 10: 76,502,702 V1388A probably benign Het
Mdga2 A T 12: 66,486,741 H223Q probably benign Het
Mgat4e G T 1: 134,541,223 P361Q probably benign Het
Mylk3 A T 8: 85,359,092 I208N possibly damaging Het
Myom2 T A 8: 15,132,667 V1368E probably damaging Het
Mypn C T 10: 63,136,294 D656N probably damaging Het
Nat10 C A 2: 103,732,203 R596L probably damaging Het
Nek8 T C 11: 78,172,527 D137G probably damaging Het
Neurl1a A G 19: 47,257,635 K552E probably damaging Het
Npdc1 C T 2: 25,408,655 H260Y probably damaging Het
Nuggc A T 14: 65,638,680 I581F probably damaging Het
Olfr930 T A 9: 38,930,855 I228N probably damaging Het
P2rx6 T C 16: 17,562,173 Y54H probably damaging Het
Pcmtd2 A G 2: 181,844,423 E112G probably damaging Het
Pcnx4 G A 12: 72,574,081 V892I probably benign Het
Pdss1 T A 2: 22,906,883 V136E possibly damaging Het
Pias3 T C 3: 96,704,937 L561P possibly damaging Het
Pomgnt1 G A 4: 116,156,256 probably benign Het
Scn2a C T 2: 65,688,630 T400I probably damaging Het
Sec24d T A 3: 123,305,785 probably null Het
Sftpb T G 6: 72,304,656 L11R probably damaging Het
Slc22a19 A G 19: 7,711,171 I8T probably benign Het
Slc22a30 A G 19: 8,386,426 S266P probably damaging Het
Slc36a2 C A 11: 55,159,388 G465W probably damaging Het
Slc4a2 G A 5: 24,439,333 M976I probably damaging Het
Smcr8 C T 11: 60,779,870 Q615* probably null Het
Sobp T C 10: 43,160,819 E41G probably damaging Het
Spz1 A T 13: 92,575,046 C307* probably null Het
Sult1d1 C T 5: 87,563,869 probably null Het
Svs1 C T 6: 48,988,570 T504I probably damaging Het
Tas2r110 T C 6: 132,868,705 M233T probably damaging Het
Tmc3 C A 7: 83,619,948 S781R probably damaging Het
Tmem234 G T 4: 129,601,937 probably benign Het
Trpm3 A T 19: 22,904,714 Q645L probably benign Het
Ttn C A 2: 76,734,711 V28391F probably damaging Het
Txnrd3 G T 6: 89,673,034 A425S probably benign Het
Ubr1 C T 2: 120,963,422 G94R probably benign Het
Ufl1 A G 4: 25,269,026 probably null Het
Utp20 T C 10: 88,768,873 D1720G probably benign Het
Vmn1r13 T A 6: 57,209,916 M20K probably benign Het
Vmn1r61 A G 7: 5,610,520 I265T probably benign Het
Zfp120 T C 2: 150,119,942 T29A probably damaging Het
Other mutations in Anxa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Anxa3 APN 5 96834771 splice site probably benign
IGL03243:Anxa3 APN 5 96828692 unclassified probably benign
F6893:Anxa3 UTSW 5 96824994 unclassified probably benign
R0026:Anxa3 UTSW 5 96838401 missense probably benign 0.01
R0468:Anxa3 UTSW 5 96811099 missense probably benign 0.00
R0562:Anxa3 UTSW 5 96812884 missense possibly damaging 0.90
R0724:Anxa3 UTSW 5 96828748 missense possibly damaging 0.70
R1442:Anxa3 UTSW 5 96828690 splice site probably null
R2276:Anxa3 UTSW 5 96830490 critical splice donor site probably null
R4922:Anxa3 UTSW 5 96820429 missense probably damaging 1.00
R5230:Anxa3 UTSW 5 96838312 missense possibly damaging 0.47
R5529:Anxa3 UTSW 5 96828379 missense probably benign 0.00
R5733:Anxa3 UTSW 5 96820472 missense probably damaging 1.00
R5857:Anxa3 UTSW 5 96828792 critical splice donor site probably null
R5902:Anxa3 UTSW 5 96812853 nonsense probably null
R6558:Anxa3 UTSW 5 96812939 splice site probably null
R6772:Anxa3 UTSW 5 96811113 missense probably damaging 0.98
R7425:Anxa3 UTSW 5 96834821 missense probably benign 0.30
R7515:Anxa3 UTSW 5 96838320 missense probably damaging 1.00
R7619:Anxa3 UTSW 5 96830404 missense probably damaging 1.00
R8018:Anxa3 UTSW 5 96820429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGAAGAAATGGCCTAAGG -3'
(R):5'- GACAGCTGTTTGTGCCATGTAG -3'

Sequencing Primer
(F):5'- GAAATGGCCTAAGGAGTTCAGTCTTC -3'
(R):5'- CCATGTAGGATGCTGTAGGAGC -3'
Posted On2016-06-15