Mutagenetix > Incidental Mutations

Incidental Mutation 'R5108:Mcm3ap'

393681

Institutional Source

Beutler Lab

Gene Symbol

Mcm3ap

Ensembl Gene

ENSMUSG00000001150

Gene Name

minichromosome maintenance complex component 3 associated protein

Synonyms

GANP

MMRRC Submission

042696-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5108 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76468927-76515857 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76502702 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1388 (V1388A)

Ref Sequence

ENSEMBL: ENSMUSP00000125960 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170795]

Predicted Effect

probably benign
Transcript: ENSMUST00000170795
AA Change: V1388A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150
AA Change: V1388A

Domain	Start	End	E-Value	Type
Pfam:NupH_GANP	2	286	3.3e-108	PFAM
low complexity region	389	403	N/A	INTRINSIC
Blast:RRM	430	504	5e-39	BLAST
SCOP:d1fjeb2	434	500	6e-4	SMART
low complexity region	544	559	N/A	INTRINSIC
low complexity region	570	586	N/A	INTRINSIC
Pfam:SAC3_GANP	677	903	1.7e-82	PFAM
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1024	1035	N/A	INTRINSIC
low complexity region	1039	1053	N/A	INTRINSIC
low complexity region	1091	1110	N/A	INTRINSIC
low complexity region	1133	1155	N/A	INTRINSIC
Pfam:CID_GANP	1156	1226	1.6e-33	PFAM
Pfam:MCM3AP_GANP	1254	1967	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219811

Meta Mutation Damage Score

0.0618

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	A	6: 23,094,208	N94Y	probably damaging	Het
Ak2	A	G	4: 129,002,241	T104A	probably damaging	Het
Alox12b	G	T	11: 69,157,382	A46S	probably benign	Het
Ank1	G	T	8: 23,132,555	V1662F	probably benign	Het
Anxa3	T	C	5: 96,830,414	I219T	possibly damaging	Het
Arhgap40	G	A	2: 158,547,679	V588M	probably damaging	Het
Arhgef38	T	C	3: 133,137,268	T514A	probably benign	Het
Ascl4	C	A	10: 85,928,558	A23E	probably benign	Het
Bcl11b	T	C	12: 107,965,726	T196A	probably benign	Het
C1ra	A	T	6: 124,522,922	Y689F	probably damaging	Het
Ccr3	A	G	9: 124,028,931	N101S	probably benign	Het
Cep70	A	T	9: 99,263,812		probably null	Het
Ces1b	A	G	8: 93,071,913	V215A	probably damaging	Het
Cndp1	A	T	18: 84,632,061	I169N	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Fbxo2	A	G	4: 148,166,029	Q275R	probably damaging	Het
Fbxo44	T	C	4: 148,158,563	N133S	probably damaging	Het
Fzr1	C	T	10: 81,369,450		probably benign	Het
Gm4778	C	T	3: 94,265,835	S50L	probably damaging	Het
Grn	T	C	11: 102,434,402	S213P	probably benign	Het
Ifi203	A	T	1: 173,924,014	C414S	probably damaging	Het
Igfn1	C	T	1: 135,982,441	R135H	probably benign	Het
Kcnk10	T	C	12: 98,435,301	M358V	probably benign	Het
Kcnn2	A	T	18: 45,592,055	Y471F	probably damaging	Het
Klhl20	A	T	1: 161,099,250	V391E	probably damaging	Het
Krt2	C	T	15: 101,813,286	G440D	possibly damaging	Het
Lpin1	A	T	12: 16,573,715	Y223N	probably benign	Het
Luzp2	G	A	7: 55,265,290	C321Y	probably damaging	Het
Mdga2	A	T	12: 66,486,741	H223Q	probably benign	Het
Mgat4e	G	T	1: 134,541,223	P361Q	probably benign	Het
Mylk3	A	T	8: 85,359,092	I208N	possibly damaging	Het
Myom2	T	A	8: 15,132,667	V1368E	probably damaging	Het
Mypn	C	T	10: 63,136,294	D656N	probably damaging	Het
Nat10	C	A	2: 103,732,203	R596L	probably damaging	Het
Nek8	T	C	11: 78,172,527	D137G	probably damaging	Het
Neurl1a	A	G	19: 47,257,635	K552E	probably damaging	Het
Npdc1	C	T	2: 25,408,655	H260Y	probably damaging	Het
Nuggc	A	T	14: 65,638,680	I581F	probably damaging	Het
Olfr930	T	A	9: 38,930,855	I228N	probably damaging	Het
P2rx6	T	C	16: 17,562,173	Y54H	probably damaging	Het
Pcmtd2	A	G	2: 181,844,423	E112G	probably damaging	Het
Pcnx4	G	A	12: 72,574,081	V892I	probably benign	Het
Pdss1	T	A	2: 22,906,883	V136E	possibly damaging	Het
Pias3	T	C	3: 96,704,937	L561P	possibly damaging	Het
Pomgnt1	G	A	4: 116,156,256		probably benign	Het
Scn2a	C	T	2: 65,688,630	T400I	probably damaging	Het
Sec24d	T	A	3: 123,305,785		probably null	Het
Sftpb	T	G	6: 72,304,656	L11R	probably damaging	Het
Slc22a19	A	G	19: 7,711,171	I8T	probably benign	Het
Slc22a30	A	G	19: 8,386,426	S266P	probably damaging	Het
Slc36a2	C	A	11: 55,159,388	G465W	probably damaging	Het
Slc4a2	G	A	5: 24,439,333	M976I	probably damaging	Het
Smcr8	C	T	11: 60,779,870	Q615*	probably null	Het
Sobp	T	C	10: 43,160,819	E41G	probably damaging	Het
Spz1	A	T	13: 92,575,046	C307*	probably null	Het
Sult1d1	C	T	5: 87,563,869		probably null	Het
Svs1	C	T	6: 48,988,570	T504I	probably damaging	Het
Tas2r110	T	C	6: 132,868,705	M233T	probably damaging	Het
Tmc3	C	A	7: 83,619,948	S781R	probably damaging	Het
Tmem234	G	T	4: 129,601,937		probably benign	Het
Trpm3	A	T	19: 22,904,714	Q645L	probably benign	Het
Ttn	C	A	2: 76,734,711	V28391F	probably damaging	Het
Txnrd3	G	T	6: 89,673,034	A425S	probably benign	Het
Ubr1	C	T	2: 120,963,422	G94R	probably benign	Het
Ufl1	A	G	4: 25,269,026		probably null	Het
Utp20	T	C	10: 88,768,873	D1720G	probably benign	Het
Vmn1r13	T	A	6: 57,209,916	M20K	probably benign	Het
Vmn1r61	A	G	7: 5,610,520	I265T	probably benign	Het
Zfp120	T	C	2: 150,119,942	T29A	probably damaging	Het

Other mutations in Mcm3ap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Mcm3ap	APN	10	76471177	missense	probably benign	0.01
IGL00742:Mcm3ap	APN	10	76492935	missense	probably damaging	1.00
IGL00898:Mcm3ap	APN	10	76470325	missense	probably benign	0.00
IGL00984:Mcm3ap	APN	10	76499566	missense	probably damaging	1.00
IGL01591:Mcm3ap	APN	10	76470805	missense	probably benign
IGL01882:Mcm3ap	APN	10	76483184	missense	possibly damaging	0.71
IGL01973:Mcm3ap	APN	10	76471117	missense	probably benign	0.00
IGL02253:Mcm3ap	APN	10	76470065	missense	probably benign	0.40
IGL02304:Mcm3ap	APN	10	76484738	missense	possibly damaging	0.65
IGL02340:Mcm3ap	APN	10	76496552	nonsense	probably null
IGL02487:Mcm3ap	APN	10	76507555	unclassified	probably benign
IGL02488:Mcm3ap	APN	10	76499649	missense	probably damaging	1.00
IGL02640:Mcm3ap	APN	10	76506421	missense	probably damaging	1.00
IGL02714:Mcm3ap	APN	10	76511033	missense	probably benign	0.00
IGL02748:Mcm3ap	APN	10	76501248	missense	probably damaging	1.00
IGL02894:Mcm3ap	APN	10	76477767	missense	probably benign	0.00
IGL02903:Mcm3ap	APN	10	76471258	splice site	probably benign
IGL02955:Mcm3ap	APN	10	76507466	missense	probably benign	0.34
IGL02989:Mcm3ap	APN	10	76471060	missense	possibly damaging	0.48
IGL03003:Mcm3ap	APN	10	76504697	missense	probably benign	0.01
IGL03081:Mcm3ap	APN	10	76470316	missense	possibly damaging	0.86
IGL03218:Mcm3ap	APN	10	76482733	missense	probably damaging	1.00
IGL03401:Mcm3ap	APN	10	76484649	splice site	probably benign
Doom	UTSW	10	76501314	missense	probably benign
woeful	UTSW	10	76481015	missense	probably benign	0.44
PIT4377001:Mcm3ap	UTSW	10	76502762	missense	possibly damaging	0.78
PIT4791001:Mcm3ap	UTSW	10	76506473	missense	probably damaging	1.00
R0105:Mcm3ap	UTSW	10	76499534	missense	probably damaging	1.00
R0144:Mcm3ap	UTSW	10	76481015	missense	probably benign	0.44
R0423:Mcm3ap	UTSW	10	76502705	missense	probably benign	0.00
R0692:Mcm3ap	UTSW	10	76483169	missense	probably damaging	1.00
R1402:Mcm3ap	UTSW	10	76477914	unclassified	probably benign
R1441:Mcm3ap	UTSW	10	76471166	missense	probably benign
R1512:Mcm3ap	UTSW	10	76470513	missense	probably damaging	1.00
R1533:Mcm3ap	UTSW	10	76504287	missense	probably damaging	1.00
R1569:Mcm3ap	UTSW	10	76483188	missense	possibly damaging	0.80
R1590:Mcm3ap	UTSW	10	76496541	missense	probably benign	0.36
R1597:Mcm3ap	UTSW	10	76483226	missense	probably damaging	1.00
R1743:Mcm3ap	UTSW	10	76484674	missense	possibly damaging	0.53
R1773:Mcm3ap	UTSW	10	76471160	missense	probably benign
R1922:Mcm3ap	UTSW	10	76507361	missense	probably damaging	1.00
R2061:Mcm3ap	UTSW	10	76470068	missense	probably benign	0.43
R2097:Mcm3ap	UTSW	10	76512489	missense	probably damaging	1.00
R2436:Mcm3ap	UTSW	10	76490057	missense	probably damaging	1.00
R3684:Mcm3ap	UTSW	10	76489426	missense	possibly damaging	0.64
R3690:Mcm3ap	UTSW	10	76482679	missense	probably damaging	1.00
R3881:Mcm3ap	UTSW	10	76506446	missense	probably benign	0.21
R4296:Mcm3ap	UTSW	10	76507337	missense	probably damaging	1.00
R4677:Mcm3ap	UTSW	10	76470570	missense	probably damaging	1.00
R4786:Mcm3ap	UTSW	10	76488466	missense	probably benign	0.00
R4882:Mcm3ap	UTSW	10	76484661	nonsense	probably null
R4907:Mcm3ap	UTSW	10	76493441	missense	probably damaging	1.00
R5279:Mcm3ap	UTSW	10	76507539	missense	probably damaging	0.96
R5316:Mcm3ap	UTSW	10	76470926	missense	possibly damaging	0.89
R5402:Mcm3ap	UTSW	10	76483314	missense	probably benign	0.04
R5459:Mcm3ap	UTSW	10	76496482	nonsense	probably null
R5473:Mcm3ap	UTSW	10	76502759	missense	probably damaging	1.00
R5570:Mcm3ap	UTSW	10	76481096	missense	possibly damaging	0.89
R5931:Mcm3ap	UTSW	10	76471166	missense	probably benign
R5939:Mcm3ap	UTSW	10	76508361	missense	probably benign	0.00
R5950:Mcm3ap	UTSW	10	76488419	missense	possibly damaging	0.46
R5998:Mcm3ap	UTSW	10	76481142	critical splice donor site	probably null
R6122:Mcm3ap	UTSW	10	76506607	missense	probably damaging	1.00
R6192:Mcm3ap	UTSW	10	76501100	missense	probably damaging	0.97
R6226:Mcm3ap	UTSW	10	76515706	missense	possibly damaging	0.95
R6293:Mcm3ap	UTSW	10	76471478	nonsense	probably null
R6669:Mcm3ap	UTSW	10	76507337	missense	probably damaging	0.98
R6715:Mcm3ap	UTSW	10	76489532	missense	possibly damaging	0.68
R6759:Mcm3ap	UTSW	10	76501314	missense	probably benign
R6864:Mcm3ap	UTSW	10	76507479	missense	probably damaging	1.00
R6870:Mcm3ap	UTSW	10	76470215	missense	probably benign	0.00
R6935:Mcm3ap	UTSW	10	76504253	missense	possibly damaging	0.84
R6947:Mcm3ap	UTSW	10	76515666	missense	probably benign	0.09
R7212:Mcm3ap	UTSW	10	76501311	missense	probably benign	0.01
R7403:Mcm3ap	UTSW	10	76482823	critical splice donor site	probably null
R7470:Mcm3ap	UTSW	10	76508397	missense	probably damaging	1.00
R7561:Mcm3ap	UTSW	10	76492878	missense	possibly damaging	0.94
R7610:Mcm3ap	UTSW	10	76496720	splice site	probably null
R7620:Mcm3ap	UTSW	10	76470433	missense	probably benign	0.00
R7898:Mcm3ap	UTSW	10	76506607	missense	probably damaging	1.00
R8266:Mcm3ap	UTSW	10	76476580	nonsense	probably null
R8355:Mcm3ap	UTSW	10	76493501	missense	probably benign	0.32
R8367:Mcm3ap	UTSW	10	76477859	missense	possibly damaging	0.65
X0026:Mcm3ap	UTSW	10	76482785	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAATTAGATTTGGTGTCTGGGACC -3'
(R):5'- TACTTCGATCATCTCAGAGTCATTG -3'

Sequencing Primer
(F):5'- CTGGGACCCTGTATCCATATGG -3'
(R):5'- CTCAGAGTCATTGAAAACCACCTTTG -3'

Posted On

2016-06-15