Incidental Mutation 'R5108:Fzr1'
ID393682
Institutional Source Beutler Lab
Gene Symbol Fzr1
Ensembl Gene ENSMUSG00000020235
Gene Namefizzy and cell division cycle 20 related 1
SynonymsCdh1, Fyr
MMRRC Submission 042696-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5108 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81366222-81378516 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 81369450 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020456] [ENSMUST00000020457] [ENSMUST00000044844] [ENSMUST00000118812] [ENSMUST00000140901]
Predicted Effect probably benign
Transcript: ENSMUST00000020456
SMART Domains Protein: ENSMUSP00000020456
Gene: ENSMUSG00000020234

DomainStartEndE-ValueType
Pfam:DUF4531 23 204 1.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020457
SMART Domains Protein: ENSMUSP00000020457
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
Blast:WD40 172 213 8e-21 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044844
SMART Domains Protein: ENSMUSP00000036116
Gene: ENSMUSG00000034854

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:MFS_2 20 423 5.2e-43 PFAM
Pfam:MFS_1 154 416 6.8e-12 PFAM
transmembrane domain 441 463 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118812
SMART Domains Protein: ENSMUSP00000112868
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
WD40 129 168 5.6e-3 SMART
WD40 171 208 6.79e-2 SMART
WD40 213 252 3.99e-8 SMART
WD40 255 297 2.84e-4 SMART
WD40 300 340 1.98e1 SMART
WD40 343 382 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130762
Predicted Effect probably benign
Transcript: ENSMUST00000131736
SMART Domains Protein: ENSMUSP00000123068
Gene: ENSMUSG00000020234

DomainStartEndE-ValueType
Pfam:DUF4531 1 128 2.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138343
Predicted Effect probably benign
Transcript: ENSMUST00000140901
SMART Domains Protein: ENSMUSP00000114203
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
Blast:WD40 172 213 1e-19 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.99e-8 SMART
WD40 344 386 2.84e-4 SMART
WD40 389 429 1.98e1 SMART
WD40 432 471 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150824
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Homozygous null mutants die embryonically at around E9.5-E12.5 with poorly developed placentae, no placental giant cells and/or erythroblast deficiency. Homozygous MEFs undergo premature senescence. Heterozygotes exhibit learning/memory defects and/or elevatedspontaneous epithelial tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,094,208 N94Y probably damaging Het
Ak2 A G 4: 129,002,241 T104A probably damaging Het
Alox12b G T 11: 69,157,382 A46S probably benign Het
Ank1 G T 8: 23,132,555 V1662F probably benign Het
Anxa3 T C 5: 96,830,414 I219T possibly damaging Het
Arhgap40 G A 2: 158,547,679 V588M probably damaging Het
Arhgef38 T C 3: 133,137,268 T514A probably benign Het
Ascl4 C A 10: 85,928,558 A23E probably benign Het
Bcl11b T C 12: 107,965,726 T196A probably benign Het
C1ra A T 6: 124,522,922 Y689F probably damaging Het
Ccr3 A G 9: 124,028,931 N101S probably benign Het
Cep70 A T 9: 99,263,812 probably null Het
Ces1b A G 8: 93,071,913 V215A probably damaging Het
Cndp1 A T 18: 84,632,061 I169N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo2 A G 4: 148,166,029 Q275R probably damaging Het
Fbxo44 T C 4: 148,158,563 N133S probably damaging Het
Gm4778 C T 3: 94,265,835 S50L probably damaging Het
Grn T C 11: 102,434,402 S213P probably benign Het
Ifi203 A T 1: 173,924,014 C414S probably damaging Het
Igfn1 C T 1: 135,982,441 R135H probably benign Het
Kcnk10 T C 12: 98,435,301 M358V probably benign Het
Kcnn2 A T 18: 45,592,055 Y471F probably damaging Het
Klhl20 A T 1: 161,099,250 V391E probably damaging Het
Krt2 C T 15: 101,813,286 G440D possibly damaging Het
Lpin1 A T 12: 16,573,715 Y223N probably benign Het
Luzp2 G A 7: 55,265,290 C321Y probably damaging Het
Mcm3ap T C 10: 76,502,702 V1388A probably benign Het
Mdga2 A T 12: 66,486,741 H223Q probably benign Het
Mgat4e G T 1: 134,541,223 P361Q probably benign Het
Mylk3 A T 8: 85,359,092 I208N possibly damaging Het
Myom2 T A 8: 15,132,667 V1368E probably damaging Het
Mypn C T 10: 63,136,294 D656N probably damaging Het
Nat10 C A 2: 103,732,203 R596L probably damaging Het
Nek8 T C 11: 78,172,527 D137G probably damaging Het
Neurl1a A G 19: 47,257,635 K552E probably damaging Het
Npdc1 C T 2: 25,408,655 H260Y probably damaging Het
Nuggc A T 14: 65,638,680 I581F probably damaging Het
Olfr930 T A 9: 38,930,855 I228N probably damaging Het
P2rx6 T C 16: 17,562,173 Y54H probably damaging Het
Pcmtd2 A G 2: 181,844,423 E112G probably damaging Het
Pcnx4 G A 12: 72,574,081 V892I probably benign Het
Pdss1 T A 2: 22,906,883 V136E possibly damaging Het
Pias3 T C 3: 96,704,937 L561P possibly damaging Het
Pomgnt1 G A 4: 116,156,256 probably benign Het
Scn2a C T 2: 65,688,630 T400I probably damaging Het
Sec24d T A 3: 123,305,785 probably null Het
Sftpb T G 6: 72,304,656 L11R probably damaging Het
Slc22a19 A G 19: 7,711,171 I8T probably benign Het
Slc22a30 A G 19: 8,386,426 S266P probably damaging Het
Slc36a2 C A 11: 55,159,388 G465W probably damaging Het
Slc4a2 G A 5: 24,439,333 M976I probably damaging Het
Smcr8 C T 11: 60,779,870 Q615* probably null Het
Sobp T C 10: 43,160,819 E41G probably damaging Het
Spz1 A T 13: 92,575,046 C307* probably null Het
Sult1d1 C T 5: 87,563,869 probably null Het
Svs1 C T 6: 48,988,570 T504I probably damaging Het
Tas2r110 T C 6: 132,868,705 M233T probably damaging Het
Tmc3 C A 7: 83,619,948 S781R probably damaging Het
Tmem234 G T 4: 129,601,937 probably benign Het
Trpm3 A T 19: 22,904,714 Q645L probably benign Het
Ttn C A 2: 76,734,711 V28391F probably damaging Het
Txnrd3 G T 6: 89,673,034 A425S probably benign Het
Ubr1 C T 2: 120,963,422 G94R probably benign Het
Ufl1 A G 4: 25,269,026 probably null Het
Utp20 T C 10: 88,768,873 D1720G probably benign Het
Vmn1r13 T A 6: 57,209,916 M20K probably benign Het
Vmn1r61 A G 7: 5,610,520 I265T probably benign Het
Zfp120 T C 2: 150,119,942 T29A probably damaging Het
Other mutations in Fzr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Fzr1 APN 10 81370525 nonsense probably null
IGL02541:Fzr1 APN 10 81370033 missense probably damaging 0.98
IGL03327:Fzr1 APN 10 81369184 missense probably benign 0.05
IGL03346:Fzr1 APN 10 81369184 missense probably benign 0.05
PIT4445001:Fzr1 UTSW 10 81369394 nonsense probably null
R0179:Fzr1 UTSW 10 81369070 splice site probably benign
R0403:Fzr1 UTSW 10 81369368 missense possibly damaging 0.95
R1591:Fzr1 UTSW 10 81370367 missense possibly damaging 0.75
R1987:Fzr1 UTSW 10 81370319 missense probably damaging 0.98
R2358:Fzr1 UTSW 10 81367640 critical splice donor site probably null
R2844:Fzr1 UTSW 10 81369418 missense probably damaging 1.00
R4657:Fzr1 UTSW 10 81367552 critical splice acceptor site probably null
R5054:Fzr1 UTSW 10 81371419 utr 5 prime probably benign
R5201:Fzr1 UTSW 10 81367528 missense probably damaging 1.00
R5494:Fzr1 UTSW 10 81371344 critical splice donor site probably null
R5663:Fzr1 UTSW 10 81370526 missense probably benign 0.00
R5733:Fzr1 UTSW 10 81370326 missense possibly damaging 0.95
R5997:Fzr1 UTSW 10 81370826 critical splice acceptor site probably null
R6777:Fzr1 UTSW 10 81370493 missense probably damaging 1.00
R7055:Fzr1 UTSW 10 81370223 missense probably damaging 1.00
R7078:Fzr1 UTSW 10 81368629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAGAGTGGCAGCAGGTTAG -3'
(R):5'- GGGTTTTAAGCAAAGCAGTTTGTAG -3'

Sequencing Primer
(F):5'- AGCAGGTTAGGACTGGCC -3'
(R):5'- GTTTGTAGAAGCAGCCTATAGCCC -3'
Posted On2016-06-15