Mutagenetix > Incidental Mutations

Incidental Mutation 'R5108:Lpin1'

393690

Institutional Source

Beutler Lab

Gene Symbol

Lpin1

Ensembl Gene

ENSMUSG00000020593

Gene Name

lipin 1

Synonyms

Lipin1

MMRRC Submission

042696-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.529) question?

Stock #

R5108 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16535669-16610966 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 16573715 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 223 (Y223N)

Ref Sequence

ENSEMBL: ENSMUSP00000152285 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067124] [ENSMUST00000111067] [ENSMUST00000221146] [ENSMUST00000221230] [ENSMUST00000221297] [ENSMUST00000222989]

Predicted Effect

probably benign
Transcript: ENSMUST00000067124
AA Change: Y223N

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000070583
Gene: ENSMUSG00000020593
AA Change: Y223N

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	110	1.1e-48	PFAM
low complexity region	153	161	N/A	INTRINSIC
low complexity region	230	242	N/A	INTRINSIC
Pfam:Lipin_mid	498	591	9.4e-36	PFAM
low complexity region	630	642	N/A	INTRINSIC
LNS2	708	864	3.42e-100	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111067
AA Change: Y223N

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000106696
Gene: ENSMUSG00000020593
AA Change: Y223N

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	2.2e-53	PFAM
low complexity region	153	161	N/A	INTRINSIC
low complexity region	237	252	N/A	INTRINSIC
low complexity region	597	609	N/A	INTRINSIC
LNS2	675	831	3.42e-100	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221146

Predicted Effect

probably benign
Transcript: ENSMUST00000221230
AA Change: Y223N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000221297
AA Change: Y223N

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000222989
AA Change: Y223N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0737

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. [provided by RefSeq, Mar 2017]
PHENOTYPE: ENU-induced mutants show transient hindlimb paralysis, demyelination and myelin sheath defects. Spontaneous mutants show neonatal fatty liver and hypertriglyceridemia, runting, male sterility, peripheral neuropathy, and altered hair growth, myelination, adipogenesis and lipid and glucose metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	A	6: 23,094,208	N94Y	probably damaging	Het
Ak2	A	G	4: 129,002,241	T104A	probably damaging	Het
Alox12b	G	T	11: 69,157,382	A46S	probably benign	Het
Ank1	G	T	8: 23,132,555	V1662F	probably benign	Het
Anxa3	T	C	5: 96,830,414	I219T	possibly damaging	Het
Arhgap40	G	A	2: 158,547,679	V588M	probably damaging	Het
Arhgef38	T	C	3: 133,137,268	T514A	probably benign	Het
Ascl4	C	A	10: 85,928,558	A23E	probably benign	Het
Bcl11b	T	C	12: 107,965,726	T196A	probably benign	Het
C1ra	A	T	6: 124,522,922	Y689F	probably damaging	Het
Ccr3	A	G	9: 124,028,931	N101S	probably benign	Het
Cep70	A	T	9: 99,263,812		probably null	Het
Ces1b	A	G	8: 93,071,913	V215A	probably damaging	Het
Cndp1	A	T	18: 84,632,061	I169N	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Fbxo2	A	G	4: 148,166,029	Q275R	probably damaging	Het
Fbxo44	T	C	4: 148,158,563	N133S	probably damaging	Het
Fzr1	C	T	10: 81,369,450		probably benign	Het
Gm4778	C	T	3: 94,265,835	S50L	probably damaging	Het
Grn	T	C	11: 102,434,402	S213P	probably benign	Het
Ifi203	A	T	1: 173,924,014	C414S	probably damaging	Het
Igfn1	C	T	1: 135,982,441	R135H	probably benign	Het
Kcnk10	T	C	12: 98,435,301	M358V	probably benign	Het
Kcnn2	A	T	18: 45,592,055	Y471F	probably damaging	Het
Klhl20	A	T	1: 161,099,250	V391E	probably damaging	Het
Krt2	C	T	15: 101,813,286	G440D	possibly damaging	Het
Luzp2	G	A	7: 55,265,290	C321Y	probably damaging	Het
Mcm3ap	T	C	10: 76,502,702	V1388A	probably benign	Het
Mdga2	A	T	12: 66,486,741	H223Q	probably benign	Het
Mgat4e	G	T	1: 134,541,223	P361Q	probably benign	Het
Mylk3	A	T	8: 85,359,092	I208N	possibly damaging	Het
Myom2	T	A	8: 15,132,667	V1368E	probably damaging	Het
Mypn	C	T	10: 63,136,294	D656N	probably damaging	Het
Nat10	C	A	2: 103,732,203	R596L	probably damaging	Het
Nek8	T	C	11: 78,172,527	D137G	probably damaging	Het
Neurl1a	A	G	19: 47,257,635	K552E	probably damaging	Het
Npdc1	C	T	2: 25,408,655	H260Y	probably damaging	Het
Nuggc	A	T	14: 65,638,680	I581F	probably damaging	Het
Olfr930	T	A	9: 38,930,855	I228N	probably damaging	Het
P2rx6	T	C	16: 17,562,173	Y54H	probably damaging	Het
Pcmtd2	A	G	2: 181,844,423	E112G	probably damaging	Het
Pcnx4	G	A	12: 72,574,081	V892I	probably benign	Het
Pdss1	T	A	2: 22,906,883	V136E	possibly damaging	Het
Pias3	T	C	3: 96,704,937	L561P	possibly damaging	Het
Pomgnt1	G	A	4: 116,156,256		probably benign	Het
Scn2a	C	T	2: 65,688,630	T400I	probably damaging	Het
Sec24d	T	A	3: 123,305,785		probably null	Het
Sftpb	T	G	6: 72,304,656	L11R	probably damaging	Het
Slc22a19	A	G	19: 7,711,171	I8T	probably benign	Het
Slc22a30	A	G	19: 8,386,426	S266P	probably damaging	Het
Slc36a2	C	A	11: 55,159,388	G465W	probably damaging	Het
Slc4a2	G	A	5: 24,439,333	M976I	probably damaging	Het
Smcr8	C	T	11: 60,779,870	Q615*	probably null	Het
Sobp	T	C	10: 43,160,819	E41G	probably damaging	Het
Spz1	A	T	13: 92,575,046	C307*	probably null	Het
Sult1d1	C	T	5: 87,563,869		probably null	Het
Svs1	C	T	6: 48,988,570	T504I	probably damaging	Het
Tas2r110	T	C	6: 132,868,705	M233T	probably damaging	Het
Tmc3	C	A	7: 83,619,948	S781R	probably damaging	Het
Tmem234	G	T	4: 129,601,937		probably benign	Het
Trpm3	A	T	19: 22,904,714	Q645L	probably benign	Het
Ttn	C	A	2: 76,734,711	V28391F	probably damaging	Het
Txnrd3	G	T	6: 89,673,034	A425S	probably benign	Het
Ubr1	C	T	2: 120,963,422	G94R	probably benign	Het
Ufl1	A	G	4: 25,269,026		probably null	Het
Utp20	T	C	10: 88,768,873	D1720G	probably benign	Het
Vmn1r13	T	A	6: 57,209,916	M20K	probably benign	Het
Vmn1r61	A	G	7: 5,610,520	I265T	probably benign	Het
Zfp120	T	C	2: 150,119,942	T29A	probably damaging	Het

Other mutations in Lpin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Lpin1	APN	12	16553992	missense	probably benign	0.00
IGL00929:Lpin1	APN	12	16573699	missense	probably benign	0.05
IGL01485:Lpin1	APN	12	16562357	splice site	probably benign
IGL01750:Lpin1	APN	12	16577176	missense	probably benign	0.00
IGL01774:Lpin1	APN	12	16558476	missense	probably damaging	0.96
IGL02197:Lpin1	APN	12	16558407	critical splice donor site	probably null
IGL02244:Lpin1	APN	12	16541769	missense	probably damaging	0.99
IGL02272:Lpin1	APN	12	16547600	missense	probably damaging	1.00
IGL03366:Lpin1	APN	12	16544677	missense	probably damaging	1.00
lipin	UTSW	12	16547499	missense	probably damaging	1.00
R0044:Lpin1	UTSW	12	16568529	splice site	probably benign
R0106:Lpin1	UTSW	12	16540979	missense	possibly damaging	0.88
R0106:Lpin1	UTSW	12	16540979	missense	possibly damaging	0.88
R0676:Lpin1	UTSW	12	16540979	missense	possibly damaging	0.88
R1119:Lpin1	UTSW	12	16563721	missense	probably damaging	1.00
R1570:Lpin1	UTSW	12	16560998	missense	possibly damaging	0.94
R1611:Lpin1	UTSW	12	16577218	missense	probably null	0.64
R1646:Lpin1	UTSW	12	16573658	critical splice donor site	probably null
R1756:Lpin1	UTSW	12	16538540	missense	probably damaging	0.99
R1870:Lpin1	UTSW	12	16541743	missense	probably damaging	1.00
R1912:Lpin1	UTSW	12	16546727	missense	probably damaging	0.96
R1971:Lpin1	UTSW	12	16580723	missense	probably damaging	1.00
R2484:Lpin1	UTSW	12	16547499	missense	probably damaging	1.00
R2901:Lpin1	UTSW	12	16553998	missense	probably benign
R3195:Lpin1	UTSW	12	16565583	missense	possibly damaging	0.91
R3779:Lpin1	UTSW	12	16564568	missense	probably damaging	0.96
R3918:Lpin1	UTSW	12	16571189	missense	probably benign	0.00
R4532:Lpin1	UTSW	12	16553962	missense	probably benign	0.01
R4857:Lpin1	UTSW	12	16563630	missense	possibly damaging	0.86
R4882:Lpin1	UTSW	12	16538536	missense	probably damaging	1.00
R5024:Lpin1	UTSW	12	16554006	missense	probably benign	0.38
R5084:Lpin1	UTSW	12	16576982	missense	probably damaging	1.00
R5191:Lpin1	UTSW	12	16580828	missense	possibly damaging	0.95
R5377:Lpin1	UTSW	12	16563655	missense	probably damaging	1.00
R5587:Lpin1	UTSW	12	16573714	missense	probably damaging	1.00
R5659:Lpin1	UTSW	12	16540989	missense	probably damaging	1.00
R5924:Lpin1	UTSW	12	16544657	missense	possibly damaging	0.91
R6391:Lpin1	UTSW	12	16564553	missense	probably benign	0.29
R6746:Lpin1	UTSW	12	16565528	missense	probably benign
R6799:Lpin1	UTSW	12	16561044	missense	probably damaging	1.00
R6969:Lpin1	UTSW	12	16580861	missense	probably damaging	0.99
R7557:Lpin1	UTSW	12	16580792	missense
R7884:Lpin1	UTSW	12	16562369	missense
R8049:Lpin1	UTSW	12	16563684	missense
R8130:Lpin1	UTSW	12	16579964	missense
R8190:Lpin1	UTSW	12	16549002	missense
R8434:Lpin1	UTSW	12	16563620	critical splice donor site	probably null
Z1177:Lpin1	UTSW	12	16579947	missense

Predicted Primers

PCR Primer
(F):5'- TCAGCGCAGGTCTGAGATTC -3'
(R):5'- AGGACATGCTAATTAGTGAGGTC -3'

Sequencing Primer
(F):5'- CGCAGGTCTGAGATTCATTTGCC -3'
(R):5'- GACATGCTAATTAGTGAGGTCCTTAG -3'

Posted On

2016-06-15