Incidental Mutation 'R0446:Polr1a'
ID39370
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
MMRRC Submission 038647-MU
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 71950664 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]
Predicted Effect probably null
Transcript: ENSMUST00000055296
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206513
Predicted Effect probably benign
Transcript: ENSMUST00000206556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206982
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 intron probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGGATGTAGCCAGCAGAGCTTC -3'
(R):5'- TCAGATGGGCATCCTGCCATTTC -3'

Sequencing Primer
(F):5'- GGCCTCCATGAGCATTCATTAG -3'
(R):5'- CCCTTGGATTTCATCACATGATGC -3'
Posted On2013-05-23