Incidental Mutation 'R5109:Rbms1'
ID393715
Institutional Source Beutler Lab
Gene Symbol Rbms1
Ensembl Gene ENSMUSG00000026970
Gene NameRNA binding motif, single stranded interacting protein 1
SynonymsMSSP-1, 2600014B10Rik, YC1, MSSP-2, MSSP-3
MMRRC Submission 042697-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5109 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60750193-60963192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60781940 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 161 (L161F)
Ref Sequence ENSEMBL: ENSMUSP00000028347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028347] [ENSMUST00000112509] [ENSMUST00000164147]
Predicted Effect probably damaging
Transcript: ENSMUST00000028347
AA Change: L161F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028347
Gene: ENSMUSG00000026970
AA Change: L161F

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
RRM 63 131 4.56e-18 SMART
RRM 142 213 2.43e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112509
AA Change: L128F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108128
Gene: ENSMUSG00000026970
AA Change: L128F

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
RRM 30 98 4.56e-18 SMART
RRM 109 180 2.43e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153555
Predicted Effect possibly damaging
Transcript: ENSMUST00000164147
AA Change: L159F

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131306
Gene: ENSMUSG00000026970
AA Change: L159F

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
RRM 61 129 4.56e-18 SMART
RRM 140 211 2.43e-13 SMART
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. Several transcript variants, resulting from alternative splicing and encoding different isoforms, have been described. A pseudogene for this locus is found on chromosome 12. [provided by RefSeq, Feb 2009]
PHENOTYPE: Only about half the expected number of mice homozygous for disruptions in this gene are produced in matings of heterozygotes. Embryo sizes are reduced. Females have smaller than normal uteri and decreased levels of progesterone during estrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T C 5: 90,243,536 S1841G possibly damaging Het
Anxa10 T C 8: 62,063,059 E193G possibly damaging Het
Ap3d1 T C 10: 80,709,450 S1056G probably benign Het
Apbb1 T C 7: 105,565,035 N62D probably damaging Het
Apobec2 A T 17: 48,422,994 Y215N probably damaging Het
Apobec2 T A 17: 48,422,996 Y214F probably damaging Het
Appl2 A T 10: 83,601,007 V630E probably benign Het
Bud23 T C 5: 135,061,023 probably benign Het
Cacna1b A T 2: 24,690,785 M683K possibly damaging Het
Cbfa2t2 T A 2: 154,531,373 D187E probably damaging Het
Cfap54 G T 10: 92,937,891 F96L probably benign Het
Crebbp A G 16: 4,088,431 probably benign Het
Crocc C T 4: 141,028,411 R1102Q probably damaging Het
Dcaf12 T C 4: 41,298,329 D273G possibly damaging Het
Dchs1 T C 7: 105,765,014 T865A probably benign Het
Dhfr A T 13: 92,355,280 I8F probably damaging Het
Dnaja2 A T 8: 85,553,258 F97L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Doc2b T C 11: 75,777,141 D261G probably benign Het
Ear1 A G 14: 43,819,028 Y128H probably benign Het
Elac2 T A 11: 64,992,316 I171N probably damaging Het
Entpd3 C A 9: 120,566,314 N454K possibly damaging Het
Flrt3 A G 2: 140,660,743 S322P possibly damaging Het
Fn1 C T 1: 71,649,235 C170Y probably damaging Het
Gabbr1 T A 17: 37,072,028 probably benign Het
Gm597 T C 1: 28,777,555 I465M possibly damaging Het
Gm7247 T G 14: 51,365,317 S37A probably damaging Het
Gm8775 T A 3: 4,211,948 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gria4 A C 9: 4,472,168 N440K probably damaging Het
H2-T22 T A 17: 36,039,221 R334* probably null Het
Ift172 T C 5: 31,265,986 D817G probably benign Het
Igkv9-124 T A 6: 67,942,364 R21S possibly damaging Het
Itgam G A 7: 128,113,218 V846I probably benign Het
Kif11 T A 19: 37,384,615 M94K possibly damaging Het
Krtcap2 T C 3: 89,246,778 V2A probably benign Het
Lrrc47 A G 4: 154,017,476 D400G probably damaging Het
Man2a1 T A 17: 64,752,448 V1110E probably benign Het
Mfsd9 T A 1: 40,774,205 I317F probably damaging Het
Mindy4 A T 6: 55,216,745 probably null Het
Mrpl53 A G 6: 83,109,560 T82A probably damaging Het
Myo3b A G 2: 70,095,293 K35E possibly damaging Het
Nalcn A G 14: 123,278,238 V1717A possibly damaging Het
Ncoa2 A G 1: 13,186,846 V143A probably damaging Het
Ndufa9 A C 6: 126,832,557 probably null Het
Odf3 A T 7: 140,849,548 S197C probably benign Het
Olfr1014 G A 2: 85,777,324 V247M probably damaging Het
Olfr1121 A G 2: 87,371,534 M1V probably null Het
Olfr1130 G A 2: 87,607,411 A8T possibly damaging Het
Olfr1130 G A 2: 87,607,975 G196R possibly damaging Het
Olfr181 A G 16: 58,926,059 S171P probably benign Het
Olfr476 T C 7: 107,967,897 S167P probably benign Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr846 A T 9: 19,361,142 I71N probably damaging Het
Pde4b G T 4: 102,601,544 A466S probably damaging Het
Pfkfb3 A T 2: 11,486,351 probably benign Het
Ppp1r21 A G 17: 88,558,840 K355E probably damaging Het
Psme4 T A 11: 30,791,095 Y90* probably null Het
Rdh16f2 A G 10: 127,866,803 D83G probably damaging Het
Sec16b C T 1: 157,564,791 R910* probably null Het
Sema4c CTGGGCTT C 1: 36,552,300 probably null Het
Stambp A G 6: 83,563,821 probably null Het
Tcf21 T C 10: 22,819,659 N82S probably damaging Het
Tlr2 A T 3: 83,837,723 V351D probably damaging Het
Tmem39a G A 16: 38,590,964 G359D probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r17 C A 5: 109,429,476 F464L probably benign Het
Vmn2r49 T A 7: 9,976,277 T843S probably benign Het
Vmn2r7 T C 3: 64,690,667 D823G probably null Het
Wrnip1 T A 13: 32,816,336 L442Q probably damaging Het
Zbtb38 G T 9: 96,687,009 S674Y probably damaging Het
Zfp639 T G 3: 32,520,436 probably null Het
Other mutations in Rbms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Rbms1 APN 2 60797705 missense probably damaging 1.00
IGL01131:Rbms1 APN 2 60758836 missense probably benign 0.00
IGL02565:Rbms1 APN 2 60759779 missense probably benign
IGL02662:Rbms1 APN 2 60762306 missense probably damaging 1.00
ANU74:Rbms1 UTSW 2 60797716 missense probably damaging 1.00
R0077:Rbms1 UTSW 2 60758835 missense possibly damaging 0.48
R0279:Rbms1 UTSW 2 60842410 missense probably damaging 0.99
R0718:Rbms1 UTSW 2 60842412 missense probably damaging 0.99
R1582:Rbms1 UTSW 2 60758835 missense possibly damaging 0.48
R2151:Rbms1 UTSW 2 60762048 splice site probably null
R4812:Rbms1 UTSW 2 60792769 missense possibly damaging 0.74
R6925:Rbms1 UTSW 2 60762304 missense probably benign 0.03
R7513:Rbms1 UTSW 2 60758821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGTACAACGGGCTCCTATG -3'
(R):5'- ATACATACCCAGCCTCGCTATG -3'

Sequencing Primer
(F):5'- AACGGGCTCCTATGACCCTG -3'
(R):5'- CCTCGCTATGTAGTACTGAAAGGTC -3'
Posted On2016-06-15