Incidental Mutation 'R5109:Cfap54'
ID 393754
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Name cilia and flagella associated protein 54
Synonyms LOC380653, Gm872, 4930485B16Rik
MMRRC Submission 042697-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R5109 (G1)
Quality Score 131
Status Validated
Chromosome 10
Chromosomal Location 92775619-93081618 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 92937891 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 96 (F96L)
Ref Sequence ENSEMBL: ENSMUSP00000129650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164979] [ENSMUST00000168110] [ENSMUST00000212902]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000067705
AA Change: F93L
Predicted Effect probably benign
Transcript: ENSMUST00000164979
AA Change: F96L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129650
Gene: ENSMUSG00000020014
AA Change: F96L

DomainStartEndE-ValueType
low complexity region 113 123 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168110
AA Change: F1957L
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: F1957L

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212902
AA Change: F2022L
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 95% (78/82)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T C 5: 90,243,536 S1841G possibly damaging Het
Anxa10 T C 8: 62,063,059 E193G possibly damaging Het
Ap3d1 T C 10: 80,709,450 S1056G probably benign Het
Apbb1 T C 7: 105,565,035 N62D probably damaging Het
Apobec2 A T 17: 48,422,994 Y215N probably damaging Het
Apobec2 T A 17: 48,422,996 Y214F probably damaging Het
Appl2 A T 10: 83,601,007 V630E probably benign Het
Bud23 T C 5: 135,061,023 probably benign Het
Cacna1b A T 2: 24,690,785 M683K possibly damaging Het
Cbfa2t2 T A 2: 154,531,373 D187E probably damaging Het
Crebbp A G 16: 4,088,431 probably benign Het
Crocc C T 4: 141,028,411 R1102Q probably damaging Het
Dcaf12 T C 4: 41,298,329 D273G possibly damaging Het
Dchs1 T C 7: 105,765,014 T865A probably benign Het
Dhfr A T 13: 92,355,280 I8F probably damaging Het
Dnaja2 A T 8: 85,553,258 F97L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Doc2b T C 11: 75,777,141 D261G probably benign Het
Ear1 A G 14: 43,819,028 Y128H probably benign Het
Elac2 T A 11: 64,992,316 I171N probably damaging Het
Entpd3 C A 9: 120,566,314 N454K possibly damaging Het
Flrt3 A G 2: 140,660,743 S322P possibly damaging Het
Fn1 C T 1: 71,649,235 C170Y probably damaging Het
Gabbr1 T A 17: 37,072,028 probably benign Het
Gm597 T C 1: 28,777,555 I465M possibly damaging Het
Gm7247 T G 14: 51,365,317 S37A probably damaging Het
Gm8775 T A 3: 4,211,948 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gria4 A C 9: 4,472,168 N440K probably damaging Het
H2-T22 T A 17: 36,039,221 R334* probably null Het
Ift172 T C 5: 31,265,986 D817G probably benign Het
Igkv9-124 T A 6: 67,942,364 R21S possibly damaging Het
Itgam G A 7: 128,113,218 V846I probably benign Het
Kif11 T A 19: 37,384,615 M94K possibly damaging Het
Krtcap2 T C 3: 89,246,778 V2A probably benign Het
Lrrc47 A G 4: 154,017,476 D400G probably damaging Het
Man2a1 T A 17: 64,752,448 V1110E probably benign Het
Mfsd9 T A 1: 40,774,205 I317F probably damaging Het
Mindy4 A T 6: 55,216,745 probably null Het
Mrpl53 A G 6: 83,109,560 T82A probably damaging Het
Myo3b A G 2: 70,095,293 K35E possibly damaging Het
Nalcn A G 14: 123,278,238 V1717A possibly damaging Het
Ncoa2 A G 1: 13,186,846 V143A probably damaging Het
Ndufa9 A C 6: 126,832,557 probably null Het
Odf3 A T 7: 140,849,548 S197C probably benign Het
Olfr1014 G A 2: 85,777,324 V247M probably damaging Het
Olfr1121 A G 2: 87,371,534 M1V probably null Het
Olfr1130 G A 2: 87,607,411 A8T possibly damaging Het
Olfr1130 G A 2: 87,607,975 G196R possibly damaging Het
Olfr181 A G 16: 58,926,059 S171P probably benign Het
Olfr476 T C 7: 107,967,897 S167P probably benign Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr846 A T 9: 19,361,142 I71N probably damaging Het
Pde4b G T 4: 102,601,544 A466S probably damaging Het
Pfkfb3 A T 2: 11,486,351 probably benign Het
Ppp1r21 A G 17: 88,558,840 K355E probably damaging Het
Psme4 T A 11: 30,791,095 Y90* probably null Het
Rbms1 G A 2: 60,781,940 L161F probably damaging Het
Rdh16f2 A G 10: 127,866,803 D83G probably damaging Het
Sec16b C T 1: 157,564,791 R910* probably null Het
Sema4c CTGGGCTT C 1: 36,552,300 probably null Het
Stambp A G 6: 83,563,821 probably null Het
Tcf21 T C 10: 22,819,659 N82S probably damaging Het
Tlr2 A T 3: 83,837,723 V351D probably damaging Het
Tmem39a G A 16: 38,590,964 G359D probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r17 C A 5: 109,429,476 F464L probably benign Het
Vmn2r49 T A 7: 9,976,277 T843S probably benign Het
Vmn2r7 T C 3: 64,690,667 D823G probably null Het
Wrnip1 T A 13: 32,816,336 L442Q probably damaging Het
Zbtb38 G T 9: 96,687,009 S674Y probably damaging Het
Zfp639 T G 3: 32,520,436 probably null Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.46
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense probably damaging 1.00
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
R7009:Cfap54 UTSW 10 92875019 missense unknown
R7129:Cfap54 UTSW 10 93016571 missense probably benign 0.06
R7131:Cfap54 UTSW 10 92821104 missense probably benign 0.03
R7171:Cfap54 UTSW 10 92776210 missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92937728 missense unknown
R7225:Cfap54 UTSW 10 92904374 missense unknown
R7270:Cfap54 UTSW 10 92839458 missense probably benign 0.03
R7323:Cfap54 UTSW 10 92801138 missense probably benign 0.00
R7380:Cfap54 UTSW 10 93047978 missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92884703 missense unknown
R7411:Cfap54 UTSW 10 92868755 missense unknown
R7503:Cfap54 UTSW 10 92887436 splice site probably null
R7622:Cfap54 UTSW 10 92956944 missense unknown
R7679:Cfap54 UTSW 10 92967512 missense probably benign 0.01
R7776:Cfap54 UTSW 10 92868741 missense unknown
R7844:Cfap54 UTSW 10 92902058 missense unknown
R7980:Cfap54 UTSW 10 92982060 missense possibly damaging 0.95
R7988:Cfap54 UTSW 10 92902079 missense unknown
R8101:Cfap54 UTSW 10 92884796 missense unknown
R8119:Cfap54 UTSW 10 92868810 missense unknown
R8134:Cfap54 UTSW 10 92878516 missense unknown
R8168:Cfap54 UTSW 10 92908877 missense unknown
R8179:Cfap54 UTSW 10 92997316 missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92962417 missense unknown
R8436:Cfap54 UTSW 10 92964536 missense unknown
R8505:Cfap54 UTSW 10 92978993 missense probably benign 0.03
R8671:Cfap54 UTSW 10 92955072 missense unknown
R8716:Cfap54 UTSW 10 92964632 missense probably benign 0.00
R8816:Cfap54 UTSW 10 92878592 missense unknown
R8822:Cfap54 UTSW 10 93039141 missense probably benign 0.09
R8827:Cfap54 UTSW 10 92938248 missense unknown
R8920:Cfap54 UTSW 10 92940337 critical splice acceptor site probably null
R8924:Cfap54 UTSW 10 93001823 missense probably damaging 0.99
R8954:Cfap54 UTSW 10 93043393 missense probably damaging 1.00
R8963:Cfap54 UTSW 10 93028700 nonsense probably null
R9010:Cfap54 UTSW 10 92899059 missense unknown
R9017:Cfap54 UTSW 10 92816021 missense probably benign 0.07
R9093:Cfap54 UTSW 10 92815908 missense probably benign 0.03
R9095:Cfap54 UTSW 10 93011020 missense probably damaging 1.00
R9142:Cfap54 UTSW 10 92984235 missense possibly damaging 0.87
R9178:Cfap54 UTSW 10 92994717 missense probably benign 0.10
R9196:Cfap54 UTSW 10 93037891 missense probably benign 0.22
R9203:Cfap54 UTSW 10 93045128 missense probably benign 0.30
R9258:Cfap54 UTSW 10 92935098 missense unknown
R9275:Cfap54 UTSW 10 93039186 missense possibly damaging 0.86
R9287:Cfap54 UTSW 10 92969703 missense possibly damaging 0.50
R9289:Cfap54 UTSW 10 92821074 missense possibly damaging 0.83
R9310:Cfap54 UTSW 10 92962315 missense unknown
R9397:Cfap54 UTSW 10 92997285 missense probably damaging 0.96
R9462:Cfap54 UTSW 10 92902058 missense unknown
R9697:Cfap54 UTSW 10 92956989 missense unknown
R9746:Cfap54 UTSW 10 92801219 missense probably benign 0.03
R9755:Cfap54 UTSW 10 92921368 missense unknown
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Z1177:Cfap54 UTSW 10 92979026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCATCGGCCTAAAGGTGG -3'
(R):5'- ATCTATCACGTGACCTGAAACAG -3'

Sequencing Primer
(F):5'- CATCGGCCTAAAGGTGGATATAACC -3'
(R):5'- TGAAACAGGCCGTCCCAAGG -3'
Posted On 2016-06-15