Mutagenetix > Incidental Mutation

Incidental Mutation 'R5109:Psme4'

393757

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

042697-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5109 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 30791095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 90 (Y90*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably null
Transcript: ENSMUST00000041231
AA Change: Y82*

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: Y82*

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000154757
AA Change: Y90*

SMART Domains

Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850
AA Change: Y90*

Domain	Start	End	E-Value	Type
low complexity region	131	142	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.2%

Validation Efficiency

95% (78/82)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd17	T	C	5: 90,243,536	S1841G	possibly damaging	Het
Anxa10	T	C	8: 62,063,059	E193G	possibly damaging	Het
Ap3d1	T	C	10: 80,709,450	S1056G	probably benign	Het
Apbb1	T	C	7: 105,565,035	N62D	probably damaging	Het
Apobec2	A	T	17: 48,422,994	Y215N	probably damaging	Het
Apobec2	T	A	17: 48,422,996	Y214F	probably damaging	Het
Appl2	A	T	10: 83,601,007	V630E	probably benign	Het
Bud23	T	C	5: 135,061,023		probably benign	Het
Cacna1b	A	T	2: 24,690,785	M683K	possibly damaging	Het
Cbfa2t2	T	A	2: 154,531,373	D187E	probably damaging	Het
Cfap54	G	T	10: 92,937,891	F96L	probably benign	Het
Crebbp	A	G	16: 4,088,431		probably benign	Het
Crocc	C	T	4: 141,028,411	R1102Q	probably damaging	Het
Dcaf12	T	C	4: 41,298,329	D273G	possibly damaging	Het
Dchs1	T	C	7: 105,765,014	T865A	probably benign	Het
Dhfr	A	T	13: 92,355,280	I8F	probably damaging	Het
Dnaja2	A	T	8: 85,553,258	F97L	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Doc2b	T	C	11: 75,777,141	D261G	probably benign	Het
Ear1	A	G	14: 43,819,028	Y128H	probably benign	Het
Elac2	T	A	11: 64,992,316	I171N	probably damaging	Het
Entpd3	C	A	9: 120,566,314	N454K	possibly damaging	Het
Flrt3	A	G	2: 140,660,743	S322P	possibly damaging	Het
Fn1	C	T	1: 71,649,235	C170Y	probably damaging	Het
Gabbr1	T	A	17: 37,072,028		probably benign	Het
Gm597	T	C	1: 28,777,555	I465M	possibly damaging	Het
Gm7247	T	G	14: 51,365,317	S37A	probably damaging	Het
Gm8775	T	A	3: 4,211,948		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Gria4	A	C	9: 4,472,168	N440K	probably damaging	Het
H2-T22	T	A	17: 36,039,221	R334*	probably null	Het
Ift172	T	C	5: 31,265,986	D817G	probably benign	Het
Igkv9-124	T	A	6: 67,942,364	R21S	possibly damaging	Het
Itgam	G	A	7: 128,113,218	V846I	probably benign	Het
Kif11	T	A	19: 37,384,615	M94K	possibly damaging	Het
Krtcap2	T	C	3: 89,246,778	V2A	probably benign	Het
Lrrc47	A	G	4: 154,017,476	D400G	probably damaging	Het
Man2a1	T	A	17: 64,752,448	V1110E	probably benign	Het
Mfsd9	T	A	1: 40,774,205	I317F	probably damaging	Het
Mindy4	A	T	6: 55,216,745		probably null	Het
Mrpl53	A	G	6: 83,109,560	T82A	probably damaging	Het
Myo3b	A	G	2: 70,095,293	K35E	possibly damaging	Het
Nalcn	A	G	14: 123,278,238	V1717A	possibly damaging	Het
Ncoa2	A	G	1: 13,186,846	V143A	probably damaging	Het
Ndufa9	A	C	6: 126,832,557		probably null	Het
Odf3	A	T	7: 140,849,548	S197C	probably benign	Het
Olfr1014	G	A	2: 85,777,324	V247M	probably damaging	Het
Olfr1121	A	G	2: 87,371,534	M1V	probably null	Het
Olfr1130	G	A	2: 87,607,411	A8T	possibly damaging	Het
Olfr1130	G	A	2: 87,607,975	G196R	possibly damaging	Het
Olfr181	A	G	16: 58,926,059	S171P	probably benign	Het
Olfr476	T	C	7: 107,967,897	S167P	probably benign	Het
Olfr771	T	C	10: 129,160,237	Y249C	probably damaging	Het
Olfr846	A	T	9: 19,361,142	I71N	probably damaging	Het
Pde4b	G	T	4: 102,601,544	A466S	probably damaging	Het
Pfkfb3	A	T	2: 11,486,351		probably benign	Het
Ppp1r21	A	G	17: 88,558,840	K355E	probably damaging	Het
Rbms1	G	A	2: 60,781,940	L161F	probably damaging	Het
Rdh16f2	A	G	10: 127,866,803	D83G	probably damaging	Het
Sec16b	C	T	1: 157,564,791	R910*	probably null	Het
Sema4c	CTGGGCTT	C	1: 36,552,300		probably null	Het
Stambp	A	G	6: 83,563,821		probably null	Het
Tcf21	T	C	10: 22,819,659	N82S	probably damaging	Het
Tlr2	A	T	3: 83,837,723	V351D	probably damaging	Het
Tmem39a	G	A	16: 38,590,964	G359D	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r17	C	A	5: 109,429,476	F464L	probably benign	Het
Vmn2r49	T	A	7: 9,976,277	T843S	probably benign	Het
Vmn2r7	T	C	3: 64,690,667	D823G	probably null	Het
Wrnip1	T	A	13: 32,816,336	L442Q	probably damaging	Het
Zbtb38	G	T	9: 96,687,009	S674Y	probably damaging	Het
Zfp639	T	G	3: 32,520,436		probably null	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGCTGAGCACAATGGATG -3'
(R):5'- ATAGTTTATACCCCATGGAGCAAAC -3'

Sequencing Primer
(F):5'- CTGAGCACAATGGATGGATTTTATCG -3'
(R):5'- ATCCCTGCATCATGCTGA -3'

Posted On

2016-06-15