Incidental Mutation 'R5109:Psme4'
ID 393757
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 042697-MU
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5109 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 30771726-30880361 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 30791095 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 90 (Y90*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably null
Transcript: ENSMUST00000041231
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: Y82*

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154757
AA Change: Y90*
SMART Domains Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850
AA Change: Y90*

DomainStartEndE-ValueType
low complexity region 131 142 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 95% (78/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T C 5: 90,243,536 S1841G possibly damaging Het
Anxa10 T C 8: 62,063,059 E193G possibly damaging Het
Ap3d1 T C 10: 80,709,450 S1056G probably benign Het
Apbb1 T C 7: 105,565,035 N62D probably damaging Het
Apobec2 A T 17: 48,422,994 Y215N probably damaging Het
Apobec2 T A 17: 48,422,996 Y214F probably damaging Het
Appl2 A T 10: 83,601,007 V630E probably benign Het
Bud23 T C 5: 135,061,023 probably benign Het
Cacna1b A T 2: 24,690,785 M683K possibly damaging Het
Cbfa2t2 T A 2: 154,531,373 D187E probably damaging Het
Cfap54 G T 10: 92,937,891 F96L probably benign Het
Crebbp A G 16: 4,088,431 probably benign Het
Crocc C T 4: 141,028,411 R1102Q probably damaging Het
Dcaf12 T C 4: 41,298,329 D273G possibly damaging Het
Dchs1 T C 7: 105,765,014 T865A probably benign Het
Dhfr A T 13: 92,355,280 I8F probably damaging Het
Dnaja2 A T 8: 85,553,258 F97L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Doc2b T C 11: 75,777,141 D261G probably benign Het
Ear1 A G 14: 43,819,028 Y128H probably benign Het
Elac2 T A 11: 64,992,316 I171N probably damaging Het
Entpd3 C A 9: 120,566,314 N454K possibly damaging Het
Flrt3 A G 2: 140,660,743 S322P possibly damaging Het
Fn1 C T 1: 71,649,235 C170Y probably damaging Het
Gabbr1 T A 17: 37,072,028 probably benign Het
Gm597 T C 1: 28,777,555 I465M possibly damaging Het
Gm7247 T G 14: 51,365,317 S37A probably damaging Het
Gm8775 T A 3: 4,211,948 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gria4 A C 9: 4,472,168 N440K probably damaging Het
H2-T22 T A 17: 36,039,221 R334* probably null Het
Ift172 T C 5: 31,265,986 D817G probably benign Het
Igkv9-124 T A 6: 67,942,364 R21S possibly damaging Het
Itgam G A 7: 128,113,218 V846I probably benign Het
Kif11 T A 19: 37,384,615 M94K possibly damaging Het
Krtcap2 T C 3: 89,246,778 V2A probably benign Het
Lrrc47 A G 4: 154,017,476 D400G probably damaging Het
Man2a1 T A 17: 64,752,448 V1110E probably benign Het
Mfsd9 T A 1: 40,774,205 I317F probably damaging Het
Mindy4 A T 6: 55,216,745 probably null Het
Mrpl53 A G 6: 83,109,560 T82A probably damaging Het
Myo3b A G 2: 70,095,293 K35E possibly damaging Het
Nalcn A G 14: 123,278,238 V1717A possibly damaging Het
Ncoa2 A G 1: 13,186,846 V143A probably damaging Het
Ndufa9 A C 6: 126,832,557 probably null Het
Odf3 A T 7: 140,849,548 S197C probably benign Het
Olfr1014 G A 2: 85,777,324 V247M probably damaging Het
Olfr1121 A G 2: 87,371,534 M1V probably null Het
Olfr1130 G A 2: 87,607,411 A8T possibly damaging Het
Olfr1130 G A 2: 87,607,975 G196R possibly damaging Het
Olfr181 A G 16: 58,926,059 S171P probably benign Het
Olfr476 T C 7: 107,967,897 S167P probably benign Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr846 A T 9: 19,361,142 I71N probably damaging Het
Pde4b G T 4: 102,601,544 A466S probably damaging Het
Pfkfb3 A T 2: 11,486,351 probably benign Het
Ppp1r21 A G 17: 88,558,840 K355E probably damaging Het
Rbms1 G A 2: 60,781,940 L161F probably damaging Het
Rdh16f2 A G 10: 127,866,803 D83G probably damaging Het
Sec16b C T 1: 157,564,791 R910* probably null Het
Sema4c CTGGGCTT C 1: 36,552,300 probably null Het
Stambp A G 6: 83,563,821 probably null Het
Tcf21 T C 10: 22,819,659 N82S probably damaging Het
Tlr2 A T 3: 83,837,723 V351D probably damaging Het
Tmem39a G A 16: 38,590,964 G359D probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r17 C A 5: 109,429,476 F464L probably benign Het
Vmn2r49 T A 7: 9,976,277 T843S probably benign Het
Vmn2r7 T C 3: 64,690,667 D823G probably null Het
Wrnip1 T A 13: 32,816,336 L442Q probably damaging Het
Zbtb38 G T 9: 96,687,009 S674Y probably damaging Het
Zfp639 T G 3: 32,520,436 probably null Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
R8491:Psme4 UTSW 11 30772161 missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30837319 missense probably benign 0.00
R8696:Psme4 UTSW 11 30809896 missense probably damaging 0.99
R8743:Psme4 UTSW 11 30878467 missense probably damaging 1.00
R8998:Psme4 UTSW 11 30838957 missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30865576 missense probably damaging 1.00
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCTGAGCACAATGGATG -3'
(R):5'- ATAGTTTATACCCCATGGAGCAAAC -3'

Sequencing Primer
(F):5'- CTGAGCACAATGGATGGATTTTATCG -3'
(R):5'- ATCCCTGCATCATGCTGA -3'
Posted On 2016-06-15