Incidental Mutation 'R5109:Gprc5c'
ID 393760
Institutional Source Beutler Lab
Gene Symbol Gprc5c
Ensembl Gene ENSMUSG00000051043
Gene Name G protein-coupled receptor, family C, group 5, member C
Synonyms
MMRRC Submission 042697-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock # R5109 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 114851152-114872617 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 114864267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 257 (V257L)
Ref Sequence ENSEMBL: ENSMUSP00000061760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000021071
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053361
AA Change: V257L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 60 301 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122967
SMART Domains Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133245
SMART Domains Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136785
AA Change: V257L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 283 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142262
SMART Domains Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 133 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152314
Predicted Effect possibly damaging
Transcript: ENSMUST00000177952
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T C 5: 90,243,536 S1841G possibly damaging Het
Anxa10 T C 8: 62,063,059 E193G possibly damaging Het
Ap3d1 T C 10: 80,709,450 S1056G probably benign Het
Apbb1 T C 7: 105,565,035 N62D probably damaging Het
Apobec2 A T 17: 48,422,994 Y215N probably damaging Het
Apobec2 T A 17: 48,422,996 Y214F probably damaging Het
Appl2 A T 10: 83,601,007 V630E probably benign Het
Bud23 T C 5: 135,061,023 probably benign Het
Cacna1b A T 2: 24,690,785 M683K possibly damaging Het
Cbfa2t2 T A 2: 154,531,373 D187E probably damaging Het
Cfap54 G T 10: 92,937,891 F96L probably benign Het
Crebbp A G 16: 4,088,431 probably benign Het
Crocc C T 4: 141,028,411 R1102Q probably damaging Het
Dcaf12 T C 4: 41,298,329 D273G possibly damaging Het
Dchs1 T C 7: 105,765,014 T865A probably benign Het
Dhfr A T 13: 92,355,280 I8F probably damaging Het
Dnaja2 A T 8: 85,553,258 F97L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Doc2b T C 11: 75,777,141 D261G probably benign Het
Ear1 A G 14: 43,819,028 Y128H probably benign Het
Elac2 T A 11: 64,992,316 I171N probably damaging Het
Entpd3 C A 9: 120,566,314 N454K possibly damaging Het
Flrt3 A G 2: 140,660,743 S322P possibly damaging Het
Fn1 C T 1: 71,649,235 C170Y probably damaging Het
Gabbr1 T A 17: 37,072,028 probably benign Het
Gm597 T C 1: 28,777,555 I465M possibly damaging Het
Gm7247 T G 14: 51,365,317 S37A probably damaging Het
Gm8775 T A 3: 4,211,948 noncoding transcript Het
Gria4 A C 9: 4,472,168 N440K probably damaging Het
H2-T22 T A 17: 36,039,221 R334* probably null Het
Ift172 T C 5: 31,265,986 D817G probably benign Het
Igkv9-124 T A 6: 67,942,364 R21S possibly damaging Het
Itgam G A 7: 128,113,218 V846I probably benign Het
Kif11 T A 19: 37,384,615 M94K possibly damaging Het
Krtcap2 T C 3: 89,246,778 V2A probably benign Het
Lrrc47 A G 4: 154,017,476 D400G probably damaging Het
Man2a1 T A 17: 64,752,448 V1110E probably benign Het
Mfsd9 T A 1: 40,774,205 I317F probably damaging Het
Mindy4 A T 6: 55,216,745 probably null Het
Mrpl53 A G 6: 83,109,560 T82A probably damaging Het
Myo3b A G 2: 70,095,293 K35E possibly damaging Het
Nalcn A G 14: 123,278,238 V1717A possibly damaging Het
Ncoa2 A G 1: 13,186,846 V143A probably damaging Het
Ndufa9 A C 6: 126,832,557 probably null Het
Odf3 A T 7: 140,849,548 S197C probably benign Het
Olfr1014 G A 2: 85,777,324 V247M probably damaging Het
Olfr1121 A G 2: 87,371,534 M1V probably null Het
Olfr1130 G A 2: 87,607,411 A8T possibly damaging Het
Olfr1130 G A 2: 87,607,975 G196R possibly damaging Het
Olfr181 A G 16: 58,926,059 S171P probably benign Het
Olfr476 T C 7: 107,967,897 S167P probably benign Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr846 A T 9: 19,361,142 I71N probably damaging Het
Pde4b G T 4: 102,601,544 A466S probably damaging Het
Pfkfb3 A T 2: 11,486,351 probably benign Het
Ppp1r21 A G 17: 88,558,840 K355E probably damaging Het
Psme4 T A 11: 30,791,095 Y90* probably null Het
Rbms1 G A 2: 60,781,940 L161F probably damaging Het
Rdh16f2 A G 10: 127,866,803 D83G probably damaging Het
Sec16b C T 1: 157,564,791 R910* probably null Het
Sema4c CTGGGCTT C 1: 36,552,300 probably null Het
Stambp A G 6: 83,563,821 probably null Het
Tcf21 T C 10: 22,819,659 N82S probably damaging Het
Tlr2 A T 3: 83,837,723 V351D probably damaging Het
Tmem39a G A 16: 38,590,964 G359D probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r17 C A 5: 109,429,476 F464L probably benign Het
Vmn2r49 T A 7: 9,976,277 T843S probably benign Het
Vmn2r7 T C 3: 64,690,667 D823G probably null Het
Wrnip1 T A 13: 32,816,336 L442Q probably damaging Het
Zbtb38 G T 9: 96,687,009 S674Y probably damaging Het
Zfp639 T G 3: 32,520,436 probably null Het
Other mutations in Gprc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Gprc5c APN 11 114864252 missense probably benign 0.01
IGL01762:Gprc5c APN 11 114864024 missense probably benign 0.28
IGL02039:Gprc5c APN 11 114864486 nonsense probably null
R0800:Gprc5c UTSW 11 114866711 missense probably damaging 0.99
R1618:Gprc5c UTSW 11 114864394 missense possibly damaging 0.88
R4198:Gprc5c UTSW 11 114863860 missense probably damaging 1.00
R4807:Gprc5c UTSW 11 114864498 missense probably damaging 0.97
R4846:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R4902:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R4904:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5016:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5048:Gprc5c UTSW 11 114870351 makesense probably null
R5106:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5173:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5266:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5267:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5475:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5508:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5557:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5562:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5563:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5598:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5599:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5729:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5756:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5792:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5793:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5794:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5817:Gprc5c UTSW 11 114863624 nonsense probably null
R5976:Gprc5c UTSW 11 114864487 missense possibly damaging 0.89
R6151:Gprc5c UTSW 11 114864025 missense probably damaging 1.00
R6617:Gprc5c UTSW 11 114864105 missense probably benign 0.05
R7108:Gprc5c UTSW 11 114864282 missense probably damaging 1.00
R7191:Gprc5c UTSW 11 114868617 missense possibly damaging 0.56
R7796:Gprc5c UTSW 11 114864532 missense probably damaging 0.97
R8543:Gprc5c UTSW 11 114864268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCAGTGCCGACTCGAC -3'
(R):5'- CCTTCAGGATGGTCTCATAGCC -3'

Sequencing Primer
(F):5'- GACCATGACCTCTCCGTGTG -3'
(R):5'- GATGGTCTCATAGCCCACCC -3'
Posted On 2016-06-15