Incidental Mutation 'R5109:Ppp1r21'
ID393775
Institutional Source Beutler Lab
Gene Symbol Ppp1r21
Ensembl Gene ENSMUSG00000034709
Gene Nameprotein phosphatase 1, regulatory subunit 21
SynonymsKlraq1, 1110018J12Rik, Ccdc128
MMRRC Submission 042697-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R5109 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location88530118-88588367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88558840 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 355 (K355E)
Ref Sequence ENSEMBL: ENSMUSP00000048443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038551]
Predicted Effect probably damaging
Transcript: ENSMUST00000038551
AA Change: K355E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048443
Gene: ENSMUSG00000034709
AA Change: K355E

DomainStartEndE-ValueType
KLRAQ 11 112 8.01e-51 SMART
coiled coil region 136 211 N/A INTRINSIC
Pfam:TTKRSYEDQ 255 771 1.8e-273 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191340
Meta Mutation Damage Score 0.6658 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 95% (78/82)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T C 5: 90,243,536 S1841G possibly damaging Het
Anxa10 T C 8: 62,063,059 E193G possibly damaging Het
Ap3d1 T C 10: 80,709,450 S1056G probably benign Het
Apbb1 T C 7: 105,565,035 N62D probably damaging Het
Apobec2 A T 17: 48,422,994 Y215N probably damaging Het
Apobec2 T A 17: 48,422,996 Y214F probably damaging Het
Appl2 A T 10: 83,601,007 V630E probably benign Het
Bud23 T C 5: 135,061,023 probably benign Het
Cacna1b A T 2: 24,690,785 M683K possibly damaging Het
Cbfa2t2 T A 2: 154,531,373 D187E probably damaging Het
Cfap54 G T 10: 92,937,891 F96L probably benign Het
Crebbp A G 16: 4,088,431 probably benign Het
Crocc C T 4: 141,028,411 R1102Q probably damaging Het
Dcaf12 T C 4: 41,298,329 D273G possibly damaging Het
Dchs1 T C 7: 105,765,014 T865A probably benign Het
Dhfr A T 13: 92,355,280 I8F probably damaging Het
Dnaja2 A T 8: 85,553,258 F97L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Doc2b T C 11: 75,777,141 D261G probably benign Het
Ear1 A G 14: 43,819,028 Y128H probably benign Het
Elac2 T A 11: 64,992,316 I171N probably damaging Het
Entpd3 C A 9: 120,566,314 N454K possibly damaging Het
Flrt3 A G 2: 140,660,743 S322P possibly damaging Het
Fn1 C T 1: 71,649,235 C170Y probably damaging Het
Gabbr1 T A 17: 37,072,028 probably benign Het
Gm597 T C 1: 28,777,555 I465M possibly damaging Het
Gm7247 T G 14: 51,365,317 S37A probably damaging Het
Gm8775 T A 3: 4,211,948 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gria4 A C 9: 4,472,168 N440K probably damaging Het
H2-T22 T A 17: 36,039,221 R334* probably null Het
Ift172 T C 5: 31,265,986 D817G probably benign Het
Igkv9-124 T A 6: 67,942,364 R21S possibly damaging Het
Itgam G A 7: 128,113,218 V846I probably benign Het
Kif11 T A 19: 37,384,615 M94K possibly damaging Het
Krtcap2 T C 3: 89,246,778 V2A probably benign Het
Lrrc47 A G 4: 154,017,476 D400G probably damaging Het
Man2a1 T A 17: 64,752,448 V1110E probably benign Het
Mfsd9 T A 1: 40,774,205 I317F probably damaging Het
Mindy4 A T 6: 55,216,745 probably null Het
Mrpl53 A G 6: 83,109,560 T82A probably damaging Het
Myo3b A G 2: 70,095,293 K35E possibly damaging Het
Nalcn A G 14: 123,278,238 V1717A possibly damaging Het
Ncoa2 A G 1: 13,186,846 V143A probably damaging Het
Ndufa9 A C 6: 126,832,557 probably null Het
Odf3 A T 7: 140,849,548 S197C probably benign Het
Olfr1014 G A 2: 85,777,324 V247M probably damaging Het
Olfr1121 A G 2: 87,371,534 M1V probably null Het
Olfr1130 G A 2: 87,607,411 A8T possibly damaging Het
Olfr1130 G A 2: 87,607,975 G196R possibly damaging Het
Olfr181 A G 16: 58,926,059 S171P probably benign Het
Olfr476 T C 7: 107,967,897 S167P probably benign Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr846 A T 9: 19,361,142 I71N probably damaging Het
Pde4b G T 4: 102,601,544 A466S probably damaging Het
Pfkfb3 A T 2: 11,486,351 probably benign Het
Psme4 T A 11: 30,791,095 Y90* probably null Het
Rbms1 G A 2: 60,781,940 L161F probably damaging Het
Rdh16f2 A G 10: 127,866,803 D83G probably damaging Het
Sec16b C T 1: 157,564,791 R910* probably null Het
Sema4c CTGGGCTT C 1: 36,552,300 probably null Het
Stambp A G 6: 83,563,821 probably null Het
Tcf21 T C 10: 22,819,659 N82S probably damaging Het
Tlr2 A T 3: 83,837,723 V351D probably damaging Het
Tmem39a G A 16: 38,590,964 G359D probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r17 C A 5: 109,429,476 F464L probably benign Het
Vmn2r49 T A 7: 9,976,277 T843S probably benign Het
Vmn2r7 T C 3: 64,690,667 D823G probably null Het
Wrnip1 T A 13: 32,816,336 L442Q probably damaging Het
Zbtb38 G T 9: 96,687,009 S674Y probably damaging Het
Zfp639 T G 3: 32,520,436 probably null Het
Other mutations in Ppp1r21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Ppp1r21 APN 17 88562102 splice site probably benign
IGL02366:Ppp1r21 APN 17 88547662 missense probably damaging 0.99
IGL02604:Ppp1r21 APN 17 88572743 missense probably benign 0.00
IGL02680:Ppp1r21 APN 17 88583862 missense probably benign 0.00
R0266:Ppp1r21 UTSW 17 88569072 splice site probably benign
R0436:Ppp1r21 UTSW 17 88565689 missense possibly damaging 0.96
R1398:Ppp1r21 UTSW 17 88542879 missense probably damaging 1.00
R1472:Ppp1r21 UTSW 17 88558605 missense probably damaging 1.00
R1599:Ppp1r21 UTSW 17 88572627 missense probably benign 0.00
R1677:Ppp1r21 UTSW 17 88550669 missense probably benign 0.04
R1760:Ppp1r21 UTSW 17 88562225 missense possibly damaging 0.78
R2571:Ppp1r21 UTSW 17 88545382 missense probably benign 0.06
R3700:Ppp1r21 UTSW 17 88582454 missense possibly damaging 0.88
R3786:Ppp1r21 UTSW 17 88577127 splice site probably null
R3959:Ppp1r21 UTSW 17 88549816 missense probably damaging 1.00
R4649:Ppp1r21 UTSW 17 88549513 missense probably benign
R4654:Ppp1r21 UTSW 17 88558799 missense probably benign 0.01
R4724:Ppp1r21 UTSW 17 88555591 nonsense probably null
R4766:Ppp1r21 UTSW 17 88572615 missense probably benign 0.00
R4933:Ppp1r21 UTSW 17 88547621 missense probably benign 0.07
R4934:Ppp1r21 UTSW 17 88545375 missense probably damaging 1.00
R4934:Ppp1r21 UTSW 17 88545376 missense probably damaging 0.98
R4992:Ppp1r21 UTSW 17 88569080 missense probably benign 0.44
R5372:Ppp1r21 UTSW 17 88550675 missense probably benign 0.21
R5861:Ppp1r21 UTSW 17 88582509 missense probably damaging 1.00
R6200:Ppp1r21 UTSW 17 88569185 missense possibly damaging 0.65
R6369:Ppp1r21 UTSW 17 88582412 splice site probably null
R7060:Ppp1r21 UTSW 17 88580544 missense probably damaging 1.00
R7154:Ppp1r21 UTSW 17 88554886 missense probably damaging 0.99
R7390:Ppp1r21 UTSW 17 88549530 missense probably benign 0.26
R7470:Ppp1r21 UTSW 17 88562221 missense probably damaging 1.00
R7475:Ppp1r21 UTSW 17 88555603 missense probably benign 0.07
R7657:Ppp1r21 UTSW 17 88555682 missense probably damaging 1.00
R8021:Ppp1r21 UTSW 17 88549507 missense probably benign 0.00
R8081:Ppp1r21 UTSW 17 88558844 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGGAAGGAATGCTGCAC -3'
(R):5'- ATTGAAACCACTGCTTATGGC -3'

Sequencing Primer
(F):5'- GAATGCTGCACTTATTCGAGAGC -3'
(R):5'- GCCTTGTGCAATGCTAACAG -3'
Posted On2016-06-15