Incidental Mutation 'R5110:Abi2'
ID393779
Institutional Source Beutler Lab
Gene Symbol Abi2
Ensembl Gene ENSMUSG00000026782
Gene Nameabl-interactor 2
Synonyms8430425M24Rik
MMRRC Submission 042698-MU
Accession Numbers

Genbank: NM_001198570.1, NM_001198571.1, NM_198127.2; Ensembl: ENSMUST00000052332, ENSMUST00000087417

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location60409619-60481158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60450121 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 98 (V98I)
Ref Sequence ENSEMBL: ENSMUSP00000139743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052332] [ENSMUST00000185788] [ENSMUST00000186097] [ENSMUST00000187709] [ENSMUST00000188594] [ENSMUST00000188618] [ENSMUST00000189082] [ENSMUST00000189980] [ENSMUST00000190158]
Predicted Effect probably benign
Transcript: ENSMUST00000052332
SMART Domains Protein: ENSMUSP00000058754
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 168 1.1e-37 PFAM
low complexity region 236 262 N/A INTRINSIC
low complexity region 335 370 N/A INTRINSIC
SH3 387 442 5.55e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000185788
AA Change: V148I
SMART Domains Protein: ENSMUSP00000139483
Gene: ENSMUSG00000026782
AA Change: V148I

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 67 4.4e-25 PFAM
low complexity region 68 81 N/A INTRINSIC
low complexity region 83 115 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 249 284 N/A INTRINSIC
SH3 301 356 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186097
AA Change: V154I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139501
Gene: ENSMUSG00000026782
AA Change: V154I

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 95 121 N/A INTRINSIC
low complexity region 125 143 N/A INTRINSIC
low complexity region 284 319 N/A INTRINSIC
SH3 336 391 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187400
Predicted Effect probably benign
Transcript: ENSMUST00000187709
SMART Domains Protein: ENSMUSP00000139867
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 165 1.8e-33 PFAM
low complexity region 166 179 N/A INTRINSIC
low complexity region 236 262 N/A INTRINSIC
low complexity region 364 399 N/A INTRINSIC
SH3 416 471 3.4e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000188594
AA Change: V246I
SMART Domains Protein: ENSMUSP00000140750
Gene: ENSMUSG00000026782
AA Change: V246I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 165 1.7e-33 PFAM
low complexity region 166 179 N/A INTRINSIC
low complexity region 181 213 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 347 382 N/A INTRINSIC
SH3 399 454 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188618
AA Change: V301I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140274
Gene: ENSMUSG00000026782
AA Change: V301I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5.1e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
low complexity region 402 437 N/A INTRINSIC
SH3 454 487 2.29e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189082
SMART Domains Protein: ENSMUSP00000140522
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 38 115 5.8e-34 PFAM
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189980
SMART Domains Protein: ENSMUSP00000141068
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 369 404 N/A INTRINSIC
SH3 421 476 5.55e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190158
AA Change: V98I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139743
Gene: ENSMUSG00000026782
AA Change: V98I

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
PDB:4N78|F 88 196 5e-62 PDB
low complexity region 226 261 N/A INTRINSIC
SH3 278 333 3.4e-26 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Homozygous null mice display microphthalmia, abnormal lens development, abnormal corpus callosum, cerebral cortex, and hippocampus morphology, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Abi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Abi2 APN 1 60447346 missense probably damaging 1.00
IGL01369:Abi2 APN 1 60437056 missense probably damaging 1.00
IGL02028:Abi2 APN 1 60434283 missense probably damaging 1.00
IGL02074:Abi2 APN 1 60447307 missense probably damaging 1.00
IGL02897:Abi2 APN 1 60448194 missense probably damaging 0.96
IGL02957:Abi2 APN 1 60470786 missense probably damaging 1.00
1mM(1):Abi2 UTSW 1 60437057 missense probably damaging 1.00
P0026:Abi2 UTSW 1 60453723 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R3946:Abi2 UTSW 1 60453754 missense probably damaging 1.00
R4793:Abi2 UTSW 1 60409804 start codon destroyed probably null 1.00
R5557:Abi2 UTSW 1 60438912 unclassified probably benign
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6368:Abi2 UTSW 1 60453651 missense possibly damaging 0.82
R6481:Abi2 UTSW 1 60438939 unclassified probably null
R7393:Abi2 UTSW 1 60434382 missense possibly damaging 0.92
R7460:Abi2 UTSW 1 60434307 missense probably damaging 1.00
R7573:Abi2 UTSW 1 60470708 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTTCACCTAATGACCTTAAGCATTC -3'
(R):5'- AAACATGAAGCTGGAGTTTCAG -3'

Sequencing Primer
(F):5'- AATGCTACTGTGACTGCC -3'
(R):5'- CATGAAGCTGGAGTTTCAGGAAAG -3'
Posted On2016-06-15