Mutagenetix > Incidental Mutations

Incidental Mutation 'R5110:Per2'

393781

Institutional Source

Beutler Lab

Gene Symbol

Per2

Ensembl Gene

ENSMUSG00000055866

Gene Name

period circadian clock 2

Synonyms

mPer2

MMRRC Submission

042698-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R5110 (G1)

Quality Score

102

Status

Validated

Chromosome

Chromosomal Location

91415982-91459324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 91429515 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 642 (T642I)

Ref Sequence

ENSEMBL: ENSMUSP00000066620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069620]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069620
AA Change: T642I

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866
AA Change: T642I

Domain	Start	End	E-Value	Type
PAS	179	246	3.23e1	SMART
PAS	319	385	5.75e-2	SMART
PAC	393	436	1.6e0	SMART
low complexity region	475	488	N/A	INTRINSIC
low complexity region	821	834	N/A	INTRINSIC
low complexity region	996	1014	N/A	INTRINSIC
Pfam:Period_C	1040	1234	2.7e-93	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	C	A	9: 124,295,357		probably null	Het
2310016G11Rik	G	A	7: 44,677,862		noncoding transcript	Het
Abi2	G	A	1: 60,450,121	V98I	probably benign	Het
Adam21	T	C	12: 81,560,215	T258A	probably benign	Het
Adam33	A	T	2: 131,053,770	C542S	probably damaging	Het
Adamts15	A	G	9: 30,921,444	V265A	probably benign	Het
Ahnak	A	T	19: 9,014,759	D4469V	probably damaging	Het
Aicda	A	G	6: 122,561,185	N101D	probably benign	Het
Als2	A	T	1: 59,185,441	D1040E	probably damaging	Het
Car15	T	C	16: 17,835,347	R319G	possibly damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Col1a1	T	C	11: 94,941,593		probably null	Het
Col25a1	A	G	3: 130,584,725	*594W	probably null	Het
Cwf19l2	A	G	9: 3,450,012		probably null	Het
Dctn4	C	T	18: 60,546,315	P236S	probably damaging	Het
Ehmt1	C	A	2: 24,852,790	C459F	probably benign	Het
Enox1	T	C	14: 77,707,687		probably null	Het
Fam136b-ps	A	G	15: 31,276,710		probably benign	Het
Fzd1	T	C	5: 4,756,448	D378G	probably benign	Het
Golga5	G	A	12: 102,472,077	R17Q	probably benign	Het
Hk1	A	T	10: 62,286,651	Y422N	probably damaging	Het
Hsf4	A	G	8: 105,272,795	D255G	probably benign	Het
Ift81	A	G	5: 122,551,058	V665A	probably benign	Het
Igkv13-84	T	C	6: 68,939,608	F3L	probably benign	Het
Kcnh1	T	A	1: 192,337,747	S433R	possibly damaging	Het
Ktn1	A	G	14: 47,704,287		probably benign	Het
Lrp4	A	T	2: 91,497,072	D1471V	possibly damaging	Het
Macf1	A	T	4: 123,368,008	D6990E	probably damaging	Het
Map3k6	G	A	4: 133,247,548		probably benign	Het
Miox	T	A	15: 89,335,556	D82E	probably benign	Het
Olfr722	T	G	14: 49,895,575	I76L	possibly damaging	Het
Ovgp1	G	C	3: 105,977,783	R133P	probably damaging	Het
Pparg	T	C	6: 115,473,003	V321A	probably damaging	Het
Pptc7	T	A	5: 122,308,249	N17K	probably benign	Het
Prpf19	T	C	19: 10,899,287		probably benign	Het
Rai14	T	C	15: 10,690,410		probably benign	Het
Sardh	T	C	2: 27,189,547	D911G	probably benign	Het
Sbf2	T	A	7: 110,364,657	T994S	probably benign	Het
Slc1a1	G	A	19: 28,911,808	E494K	probably benign	Het
Smarcc1	A	G	9: 110,197,784	K771E	possibly damaging	Het
St5	A	G	7: 109,542,490	S556P	probably benign	Het
Stim1	T	C	7: 102,268,422	V3A	unknown	Het
Syne3	G	A	12: 104,943,370	R736C	probably benign	Het
Synj2	T	C	17: 6,037,715	V986A	probably benign	Het
Tinag	A	G	9: 76,952,007	S440P	probably damaging	Het
Tshz2	A	G	2: 169,884,197	T238A	possibly damaging	Het
Ttc8	T	C	12: 98,942,303	M17T	probably benign	Het
Tubgcp5	G	A	7: 55,808,637	R432Q	probably damaging	Het
Ugt1a10	T	A	1: 88,056,252		probably null	Het
Usp4	T	A	9: 108,362,678	I202N	probably damaging	Het
Vmn1r194	T	G	13: 22,245,000	S262R	probably benign	Het
Vmn2r101	T	C	17: 19,611,635	F631S	possibly damaging	Het
Vps13b	T	A	15: 35,770,809	S2133T	probably damaging	Het
Zfp13	C	A	17: 23,580,860	V77F	probably benign	Het
Zscan10	T	A	17: 23,609,632	C306S	probably damaging	Het

Other mutations in Per2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Per2	APN	1	91448833	missense	probably damaging	0.98
IGL01350:Per2	APN	1	91430861	missense	probably damaging	1.00
IGL01865:Per2	APN	1	91421517	missense	probably benign	0.10
IGL01974:Per2	APN	1	91423718	missense	probably benign	0.02
IGL02118:Per2	APN	1	91424309	missense	probably damaging	0.99
IGL02271:Per2	APN	1	91445610	missense	probably damaging	1.00
IGL02533:Per2	APN	1	91431002	missense	possibly damaging	0.92
IGL02707:Per2	APN	1	91450728	missense	possibly damaging	0.94
IGL02972:Per2	APN	1	91423981	missense	possibly damaging	0.50
IGL03118:Per2	APN	1	91444619	nonsense	probably null
IGL03125:Per2	APN	1	91450611	missense	probably benign	0.00
IGL03375:Per2	APN	1	91424228	missense	possibly damaging	0.76
IGL03388:Per2	APN	1	91444789	splice site	probably benign
Kortiku	UTSW	1	91423829	missense	probably damaging	1.00
obst	UTSW	1	91445539	missense	probably benign	0.00
rhythm	UTSW	1	91429382	critical splice donor site	probably null
ANU23:Per2	UTSW	1	91448833	missense	probably damaging	0.98
R0029:Per2	UTSW	1	91423712	missense	possibly damaging	0.58
R0029:Per2	UTSW	1	91423712	missense	possibly damaging	0.58
R0542:Per2	UTSW	1	91438332	critical splice donor site	probably null
R0764:Per2	UTSW	1	91429420	missense	probably damaging	1.00
R1370:Per2	UTSW	1	91445557	missense	possibly damaging	0.94
R1655:Per2	UTSW	1	91448768	missense	probably damaging	1.00
R1688:Per2	UTSW	1	91423829	missense	probably damaging	1.00
R1997:Per2	UTSW	1	91440859	missense	probably damaging	1.00
R2891:Per2	UTSW	1	91445603	missense	probably damaging	1.00
R2893:Per2	UTSW	1	91445603	missense	probably damaging	1.00
R2894:Per2	UTSW	1	91445603	missense	probably damaging	1.00
R3109:Per2	UTSW	1	91445575	missense	probably benign	0.02
R4125:Per2	UTSW	1	91429450	missense	possibly damaging	0.71
R4997:Per2	UTSW	1	91450783	missense	probably benign	0.02
R5478:Per2	UTSW	1	91432868	missense	probably benign	0.09
R5590:Per2	UTSW	1	91427856	nonsense	probably null
R5634:Per2	UTSW	1	91444707	missense	probably benign	0.02
R5654:Per2	UTSW	1	91445501	splice site	probably null
R5928:Per2	UTSW	1	91444651	missense	probably damaging	1.00
R6241:Per2	UTSW	1	91421529	missense	probably damaging	0.97
R6295:Per2	UTSW	1	91449872	missense	unknown
R6345:Per2	UTSW	1	91448722	missense	probably damaging	1.00
R6480:Per2	UTSW	1	91429382	critical splice donor site	probably null
R6502:Per2	UTSW	1	91427763	missense	probably benign	0.01
R6702:Per2	UTSW	1	91427949	missense	probably damaging	1.00
R6703:Per2	UTSW	1	91427949	missense	probably damaging	1.00
R6790:Per2	UTSW	1	91445539	missense	probably benign	0.00
R7043:Per2	UTSW	1	91419408	missense	probably benign
R7092:Per2	UTSW	1	91421431	missense	probably damaging	1.00
R7430:Per2	UTSW	1	91423983	nonsense	probably null
R7555:Per2	UTSW	1	91435135	missense	probably damaging	1.00
R7860:Per2	UTSW	1	91444759	missense	probably damaging	0.99
R8046:Per2	UTSW	1	91435703	missense	possibly damaging	0.56
R8142:Per2	UTSW	1	91421547	missense	possibly damaging	0.90
R8261:Per2	UTSW	1	91433448	missense	possibly damaging	0.87
R8277:Per2	UTSW	1	91420552	missense	probably benign	0.15
R8534:Per2	UTSW	1	91423937	missense	probably benign	0.09
X0011:Per2	UTSW	1	91420589	missense	possibly damaging	0.85
Z1176:Per2	UTSW	1	91421493	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCAGGCTGCTGTTGAAATTCC -3'
(R):5'- GGACTCTGAGAGTGAAGTTCAAGTTG -3'

Sequencing Primer
(F):5'- AAATTCCCCAGGGATCTGTG -3'
(R):5'- AGAGTGAAGTTCAAGTTGCTCCC -3'

Posted On

2016-06-15