Incidental Mutation 'R5110:Adam33'
ID393786
Institutional Source Beutler Lab
Gene Symbol Adam33
Ensembl Gene ENSMUSG00000027318
Gene Namea disintegrin and metallopeptidase domain 33
Synonyms
MMRRC Submission 042698-MU
Accession Numbers

Genbank: NM_033615, NM_001163529; MGI: 1341813

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131050591-131063814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131053770 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 542 (C542S)
Ref Sequence ENSEMBL: ENSMUSP00000139344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052104] [ENSMUST00000110232] [ENSMUST00000183552]
Predicted Effect probably damaging
Transcript: ENSMUST00000052104
AA Change: C542S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052486
Gene: ENSMUSG00000027318
AA Change: C542S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 168 1.9e-28 PFAM
Pfam:Reprolysin_5 209 390 6.9e-21 PFAM
Pfam:Reprolysin_4 209 401 3.5e-9 PFAM
Pfam:Reprolysin 211 410 1.9e-60 PFAM
Pfam:Reprolysin_2 232 400 3e-14 PFAM
Pfam:Reprolysin_3 235 357 1.2e-16 PFAM
DISIN 427 502 8.4e-42 SMART
ACR 503 647 6.8e-51 SMART
transmembrane domain 677 699 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110232
AA Change: C542S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105861
Gene: ENSMUSG00000027318
AA Change: C542S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 36 168 1.3e-24 PFAM
Pfam:Reprolysin_5 209 390 8.5e-23 PFAM
Pfam:Reprolysin_4 209 401 4.2e-11 PFAM
Pfam:Reprolysin 211 410 4e-63 PFAM
Pfam:Reprolysin_2 231 400 7.3e-17 PFAM
Pfam:Reprolysin_3 235 357 2.2e-20 PFAM
DISIN 427 502 1.66e-39 SMART
ACR 503 646 7.59e-54 SMART
EGF 653 682 1.53e-1 SMART
transmembrane domain 703 725 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134742
Predicted Effect unknown
Transcript: ENSMUST00000135149
AA Change: C400S
SMART Domains Protein: ENSMUSP00000122608
Gene: ENSMUSG00000027318
AA Change: C400S

DomainStartEndE-ValueType
Pfam:Reprolysin_5 68 249 1.8e-23 PFAM
Pfam:Reprolysin_4 68 260 8.6e-12 PFAM
Pfam:Reprolysin 70 269 8.3e-64 PFAM
Pfam:Reprolysin_2 90 259 1.5e-17 PFAM
Pfam:Reprolysin_3 94 216 5.1e-21 PFAM
DISIN 286 361 1.66e-39 SMART
ACR 362 505 8.02e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147333
SMART Domains Protein: ENSMUSP00000117097
Gene: ENSMUSG00000027318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149625
Predicted Effect probably damaging
Transcript: ENSMUST00000183552
AA Change: C542S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139344
Gene: ENSMUSG00000027318
AA Change: C542S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 168 2.4e-30 PFAM
Pfam:Reprolysin_5 209 390 8.2e-23 PFAM
Pfam:Reprolysin_4 209 401 4.2e-11 PFAM
Pfam:Reprolysin 211 410 2.4e-62 PFAM
Pfam:Reprolysin_2 232 400 2.8e-16 PFAM
Pfam:Reprolysin_3 235 357 1.5e-18 PFAM
DISIN 427 502 1.66e-39 SMART
ACR 503 646 7.59e-54 SMART
EGF 653 682 1.53e-1 SMART
transmembrane domain 703 725 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000184921
AA Change: H55Q
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is widely expressed, most highly in the adult brain, heart, kidney, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a targeted gene deletion are viable, fertile, developmentally normal and display normal allergen-induced airway hyperreactivity, IgE production, mucus metaplasia, and airway inflammation in an OVA-induced model of allergic asthma. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Adam33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adam33 APN 2 131054263 splice site probably benign
IGL01586:Adam33 APN 2 131054050 missense probably damaging 1.00
IGL02156:Adam33 APN 2 131053158 splice site probably benign
IGL02498:Adam33 APN 2 131053237 missense probably damaging 1.00
3-1:Adam33 UTSW 2 131054121 splice site probably null
R0012:Adam33 UTSW 2 131052920 missense probably damaging 1.00
R0471:Adam33 UTSW 2 131054479 missense probably damaging 0.99
R1401:Adam33 UTSW 2 131051471 unclassified probably benign
R2071:Adam33 UTSW 2 131055346 missense probably benign 0.01
R2095:Adam33 UTSW 2 131053709 missense probably damaging 1.00
R2383:Adam33 UTSW 2 131051362 missense probably benign 0.01
R4077:Adam33 UTSW 2 131063524 utr 5 prime probably benign
R4403:Adam33 UTSW 2 131053270 missense probably benign 0.03
R4821:Adam33 UTSW 2 131061195 missense probably benign 0.03
R5150:Adam33 UTSW 2 131053197 intron probably benign
R5364:Adam33 UTSW 2 131054472 critical splice donor site probably null
R5632:Adam33 UTSW 2 131053442 missense probably damaging 1.00
R5818:Adam33 UTSW 2 131054358 missense possibly damaging 0.51
R6226:Adam33 UTSW 2 131055610 missense probably damaging 1.00
R6478:Adam33 UTSW 2 131051346 missense probably benign 0.01
R6755:Adam33 UTSW 2 131053149 missense probably damaging 1.00
R7230:Adam33 UTSW 2 131053563 missense probably damaging 1.00
R7322:Adam33 UTSW 2 131053694 missense probably damaging 1.00
R7395:Adam33 UTSW 2 131061169 missense probably benign 0.00
R7650:Adam33 UTSW 2 131061147 missense probably damaging 1.00
R7783:Adam33 UTSW 2 131058337 missense unknown
R7809:Adam33 UTSW 2 131051346 missense probably benign
Z1177:Adam33 UTSW 2 131058662 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGCAGTTTCCCACACAGAG -3'
(R):5'- TTACCTACTGGATGGCTCACCC -3'

Sequencing Primer
(F):5'- GTTTCCCACACAGAGCGTCC -3'
(R):5'- TAGACGGCTGGTGTCCCAC -3'
Posted On2016-06-15