Incidental Mutation 'R5110:Tubgcp5'
ID393800
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Nametubulin, gamma complex associated protein 5
SynonymsB130010C12Rik, GCP5
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location55794154-55831677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55808637 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 432 (R432Q)
Ref Sequence ENSEMBL: ENSMUSP00000146111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191]
Predicted Effect probably damaging
Transcript: ENSMUST00000032627
AA Change: R432Q

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: R432Q

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205779
Predicted Effect probably damaging
Transcript: ENSMUST00000205796
AA Change: R432Q

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206789
Meta Mutation Damage Score 0.6716 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55806595 missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55808529 missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55796031 splice site probably benign
IGL01597:Tubgcp5 APN 7 55806832 splice site probably benign
IGL01688:Tubgcp5 APN 7 55815018 missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55799473 missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55806088 missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55818757 missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55806607 nonsense probably null
IGL03105:Tubgcp5 APN 7 55825581 missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55808529 missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55814978 missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55800684 missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55823567 missense probably benign
R0488:Tubgcp5 UTSW 7 55829338 missense probably damaging 0.96
R0853:Tubgcp5 UTSW 7 55814851 splice site probably benign
R0885:Tubgcp5 UTSW 7 55806055 nonsense probably null
R1483:Tubgcp5 UTSW 7 55825707 critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55808537 missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55815020 missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55799511 missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55830881 missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55830866 missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55794185 unclassified probably benign
R4948:Tubgcp5 UTSW 7 55806123 missense probably benign 0.00
R5347:Tubgcp5 UTSW 7 55823685 missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55814962 missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55823609 missense probably benign
R6141:Tubgcp5 UTSW 7 55806778 missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55795923 missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55817392 nonsense probably null
R6563:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55823583 missense probably benign
R6596:Tubgcp5 UTSW 7 55806634 missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55794229 missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55805366 missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55829407 missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55800695 nonsense probably null
R7213:Tubgcp5 UTSW 7 55806112 missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55823567 missense probably benign
R7600:Tubgcp5 UTSW 7 55808513 missense probably benign
R7813:Tubgcp5 UTSW 7 55800696 missense possibly damaging 0.49
R7948:Tubgcp5 UTSW 7 55794248 missense not run
Z1088:Tubgcp5 UTSW 7 55815101 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGTGCCTTTCCATATGTCAAAG -3'
(R):5'- ACTGCCTGACATACCATGAG -3'

Sequencing Primer
(F):5'- GCCTTTCCATATGTCAAAGAAAAGGC -3'
(R):5'- TGCCTGACATACCATGAGTTAAAC -3'
Posted On2016-06-15