Incidental Mutation 'R5110:Cwf19l2'
ID393805
Institutional Source Beutler Lab
Gene Symbol Cwf19l2
Ensembl Gene ENSMUSG00000025898
Gene NameCWF19-like 2, cell cycle control (S. pombe)
Synonyms3230401L03Rik
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location3403592-3479236 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 3450012 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027027]
Predicted Effect probably null
Transcript: ENSMUST00000027027
SMART Domains Protein: ENSMUSP00000027027
Gene: ENSMUSG00000025898

DomainStartEndE-ValueType
low complexity region 64 114 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
coiled coil region 496 524 N/A INTRINSIC
Pfam:CwfJ_C_1 655 779 1.8e-40 PFAM
Pfam:CwfJ_C_2 788 882 4.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212101
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Cwf19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Cwf19l2 APN 9 3409990 missense probably benign 0.01
IGL00573:Cwf19l2 APN 9 3450161 splice site probably benign
IGL00757:Cwf19l2 APN 9 3460054 missense probably damaging 1.00
IGL00803:Cwf19l2 APN 9 3430810 missense probably benign 0.41
IGL01916:Cwf19l2 APN 9 3477869 missense possibly damaging 0.82
IGL02315:Cwf19l2 APN 9 3410030 missense probably damaging 1.00
IGL02419:Cwf19l2 APN 9 3418777 critical splice donor site probably null
IGL02427:Cwf19l2 APN 9 3456817 missense probably benign 0.00
IGL03026:Cwf19l2 APN 9 3428777 missense probably benign 0.28
IGL03028:Cwf19l2 APN 9 3430622 missense probably benign 0.26
IGL03199:Cwf19l2 APN 9 3477830 missense probably damaging 1.00
R0015:Cwf19l2 UTSW 9 3454666 missense probably benign 0.00
R0015:Cwf19l2 UTSW 9 3454666 missense probably benign 0.00
R0532:Cwf19l2 UTSW 9 3431057 missense probably benign 0.38
R0724:Cwf19l2 UTSW 9 3421377 critical splice donor site probably null
R0924:Cwf19l2 UTSW 9 3441047 splice site probably benign
R0947:Cwf19l2 UTSW 9 3421286 missense probably benign 0.16
R1210:Cwf19l2 UTSW 9 3430810 missense probably benign 0.00
R1393:Cwf19l2 UTSW 9 3456818 missense probably benign 0.01
R1541:Cwf19l2 UTSW 9 3456760 missense probably damaging 1.00
R1594:Cwf19l2 UTSW 9 3430973 missense probably benign
R1870:Cwf19l2 UTSW 9 3458802 missense possibly damaging 0.56
R1950:Cwf19l2 UTSW 9 3418674 missense probably benign
R1996:Cwf19l2 UTSW 9 3417947 missense probably benign 0.01
R2005:Cwf19l2 UTSW 9 3430720 missense possibly damaging 0.92
R2246:Cwf19l2 UTSW 9 3430661 missense probably benign 0.16
R2420:Cwf19l2 UTSW 9 3411341 missense possibly damaging 0.80
R3051:Cwf19l2 UTSW 9 3410006 missense probably benign 0.05
R3738:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R3915:Cwf19l2 UTSW 9 3456776 missense probably damaging 1.00
R4034:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R4035:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R4323:Cwf19l2 UTSW 9 3430452 missense probably damaging 0.99
R4328:Cwf19l2 UTSW 9 3458878 missense probably damaging 1.00
R4329:Cwf19l2 UTSW 9 3458878 missense probably damaging 1.00
R4692:Cwf19l2 UTSW 9 3428709 missense probably damaging 1.00
R4775:Cwf19l2 UTSW 9 3430973 missense probably benign
R4779:Cwf19l2 UTSW 9 3410035 missense possibly damaging 0.95
R4822:Cwf19l2 UTSW 9 3458839 missense probably damaging 1.00
R4833:Cwf19l2 UTSW 9 3430783 missense probably benign 0.28
R5120:Cwf19l2 UTSW 9 3418761 nonsense probably null
R5164:Cwf19l2 UTSW 9 3475511 missense probably damaging 1.00
R5440:Cwf19l2 UTSW 9 3475549 missense probably damaging 1.00
R5567:Cwf19l2 UTSW 9 3456831 missense probably damaging 1.00
R5594:Cwf19l2 UTSW 9 3418773 missense probably benign 0.42
R5960:Cwf19l2 UTSW 9 3411404 missense probably benign 0.43
R6222:Cwf19l2 UTSW 9 3454569 nonsense probably null
R6259:Cwf19l2 UTSW 9 3458879 missense probably damaging 1.00
R6688:Cwf19l2 UTSW 9 3450015 missense probably benign 0.00
R6983:Cwf19l2 UTSW 9 3477817 missense probably damaging 1.00
R7063:Cwf19l2 UTSW 9 3430532 missense probably benign 0.03
R7506:Cwf19l2 UTSW 9 3456775 missense probably damaging 1.00
R7733:Cwf19l2 UTSW 9 3450066 missense probably benign 0.19
R7846:Cwf19l2 UTSW 9 3477889 missense probably damaging 1.00
R7900:Cwf19l2 UTSW 9 3460107 missense probably damaging 1.00
R7929:Cwf19l2 UTSW 9 3477889 missense probably damaging 1.00
R7983:Cwf19l2 UTSW 9 3460107 missense probably damaging 1.00
T0722:Cwf19l2 UTSW 9 3456755 missense probably benign 0.00
X0003:Cwf19l2 UTSW 9 3456755 missense probably benign 0.00
X0020:Cwf19l2 UTSW 9 3418662 missense probably damaging 1.00
Z1177:Cwf19l2 UTSW 9 3428782 missense not run
Predicted Primers PCR Primer
(F):5'- TCTTAAACAAAACTCGGCAGTCAG -3'
(R):5'- GAATCAGTTTCTCAAAATGCAAAGG -3'

Sequencing Primer
(F):5'- AACTCGGCAGTCAGCTAGTGTG -3'
(R):5'- CAAAGGTTTGCTGAGACTCTCTTAC -3'
Posted On2016-06-15