Incidental Mutation 'R5110:Col1a1'
ID393811
Institutional Source Beutler Lab
Gene Symbol Col1a1
Ensembl Gene ENSMUSG00000001506
Gene Namecollagen, type I, alpha 1
SynonymsCola1, Mov-13, Col1a-1, Cola-1
MMRRC Submission 042698-MU
Accession Numbers

MGI: 88467

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94936224-94953042 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 94941593 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001547] [ENSMUST00000001547] [ENSMUST00000001547]
Predicted Effect probably null
Transcript: ENSMUST00000001547
SMART Domains Protein: ENSMUSP00000001547
Gene: ENSMUSG00000001506

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWC 31 86 1.04e-16 SMART
Pfam:Collagen 97 154 1.1e-9 PFAM
Pfam:Collagen 166 227 7e-10 PFAM
Pfam:Collagen 225 284 2.4e-13 PFAM
Pfam:Collagen 285 344 5.9e-12 PFAM
low complexity region 354 426 N/A INTRINSIC
internal_repeat_4 427 444 4.93e-7 PROSPERO
low complexity region 447 486 N/A INTRINSIC
low complexity region 495 516 N/A INTRINSIC
low complexity region 527 567 N/A INTRINSIC
internal_repeat_3 570 588 1.25e-9 PROSPERO
low complexity region 590 600 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 629 651 N/A INTRINSIC
internal_repeat_1 652 675 6.29e-11 PROSPERO
internal_repeat_4 658 675 4.93e-7 PROSPERO
low complexity region 678 699 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
internal_repeat_2 718 738 2.08e-10 PROSPERO
internal_repeat_1 718 741 6.29e-11 PROSPERO
internal_repeat_3 726 744 1.25e-9 PROSPERO
internal_repeat_5 737 752 9.8e-6 PROSPERO
Pfam:Collagen 768 827 2.8e-12 PFAM
Pfam:Collagen 828 887 6.8e-11 PFAM
internal_repeat_5 944 959 9.8e-6 PROSPERO
internal_repeat_2 952 972 2.08e-10 PROSPERO
Pfam:Collagen 1008 1077 4.8e-8 PFAM
Pfam:Collagen 1068 1127 1.2e-12 PFAM
Pfam:Collagen 1122 1184 2.8e-9 PFAM
PDB:3HR2|C 1185 1205 6e-6 PDB
COLFI 1217 1453 2.04e-162 SMART
Predicted Effect probably null
Transcript: ENSMUST00000001547
SMART Domains Protein: ENSMUSP00000001547
Gene: ENSMUSG00000001506

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWC 31 86 1.04e-16 SMART
Pfam:Collagen 97 154 1.1e-9 PFAM
Pfam:Collagen 166 227 7e-10 PFAM
Pfam:Collagen 225 284 2.4e-13 PFAM
Pfam:Collagen 285 344 5.9e-12 PFAM
low complexity region 354 426 N/A INTRINSIC
internal_repeat_4 427 444 4.93e-7 PROSPERO
low complexity region 447 486 N/A INTRINSIC
low complexity region 495 516 N/A INTRINSIC
low complexity region 527 567 N/A INTRINSIC
internal_repeat_3 570 588 1.25e-9 PROSPERO
low complexity region 590 600 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 629 651 N/A INTRINSIC
internal_repeat_1 652 675 6.29e-11 PROSPERO
internal_repeat_4 658 675 4.93e-7 PROSPERO
low complexity region 678 699 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
internal_repeat_2 718 738 2.08e-10 PROSPERO
internal_repeat_1 718 741 6.29e-11 PROSPERO
internal_repeat_3 726 744 1.25e-9 PROSPERO
internal_repeat_5 737 752 9.8e-6 PROSPERO
Pfam:Collagen 768 827 2.8e-12 PFAM
Pfam:Collagen 828 887 6.8e-11 PFAM
internal_repeat_5 944 959 9.8e-6 PROSPERO
internal_repeat_2 952 972 2.08e-10 PROSPERO
Pfam:Collagen 1008 1077 4.8e-8 PFAM
Pfam:Collagen 1068 1127 1.2e-12 PFAM
Pfam:Collagen 1122 1184 2.8e-9 PFAM
PDB:3HR2|C 1185 1205 6e-6 PDB
COLFI 1217 1453 2.04e-162 SMART
Predicted Effect probably null
Transcript: ENSMUST00000001547
SMART Domains Protein: ENSMUSP00000001547
Gene: ENSMUSG00000001506

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWC 31 86 1.04e-16 SMART
Pfam:Collagen 97 154 1.1e-9 PFAM
Pfam:Collagen 166 227 7e-10 PFAM
Pfam:Collagen 225 284 2.4e-13 PFAM
Pfam:Collagen 285 344 5.9e-12 PFAM
low complexity region 354 426 N/A INTRINSIC
internal_repeat_4 427 444 4.93e-7 PROSPERO
low complexity region 447 486 N/A INTRINSIC
low complexity region 495 516 N/A INTRINSIC
low complexity region 527 567 N/A INTRINSIC
internal_repeat_3 570 588 1.25e-9 PROSPERO
low complexity region 590 600 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 629 651 N/A INTRINSIC
internal_repeat_1 652 675 6.29e-11 PROSPERO
internal_repeat_4 658 675 4.93e-7 PROSPERO
low complexity region 678 699 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
internal_repeat_2 718 738 2.08e-10 PROSPERO
internal_repeat_1 718 741 6.29e-11 PROSPERO
internal_repeat_3 726 744 1.25e-9 PROSPERO
internal_repeat_5 737 752 9.8e-6 PROSPERO
Pfam:Collagen 768 827 2.8e-12 PFAM
Pfam:Collagen 828 887 6.8e-11 PFAM
internal_repeat_5 944 959 9.8e-6 PROSPERO
internal_repeat_2 952 972 2.08e-10 PROSPERO
Pfam:Collagen 1008 1077 4.8e-8 PFAM
Pfam:Collagen 1068 1127 1.2e-12 PFAM
Pfam:Collagen 1122 1184 2.8e-9 PFAM
PDB:3HR2|C 1185 1205 6e-6 PDB
COLFI 1217 1453 2.04e-162 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148593
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-2 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice lacking the encoded protein die in utero caused by the rupture of a major blood vessel. Transgenic mice expressing significantly lower levels of this gene exhibit morphological and functional defects in mineralized and non-mineralized connective tissue and, progressive loss of hearing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutations in this locus cause variable phenotype, from embryonic lethal to viable/fertile with altered fibrillogenesis. Homozygotes can show impaired bone formation and fragility, osteoporosis, dermal fibrosis, impaired uterine postpartum involution, andaortic dissection. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Targeted(40) Gene trapped(3) Transgenic(1) Chemically induced(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Col1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col1a1 APN 11 94949378 missense unknown
IGL01383:Col1a1 APN 11 94945525 missense probably damaging 1.00
IGL01717:Col1a1 APN 11 94950777 missense unknown
IGL02889:Col1a1 APN 11 94951509 missense unknown
seal UTSW 11 94947184 splice site probably benign
walrus UTSW 11 94942385 missense unknown
R0121:Col1a1 UTSW 11 94938069 missense unknown
R0400:Col1a1 UTSW 11 94941369 splice site probably benign
R0545:Col1a1 UTSW 11 94951594 missense unknown
R0661:Col1a1 UTSW 11 94949389 missense unknown
R1220:Col1a1 UTSW 11 94951131 missense unknown
R1717:Col1a1 UTSW 11 94948392 missense unknown
R1732:Col1a1 UTSW 11 94944415 splice site probably benign
R1879:Col1a1 UTSW 11 94951225 missense unknown
R1880:Col1a1 UTSW 11 94950568 missense unknown
R1901:Col1a1 UTSW 11 94946632 splice site probably null
R2113:Col1a1 UTSW 11 94948362 missense unknown
R2386:Col1a1 UTSW 11 94950391 missense unknown
R3803:Col1a1 UTSW 11 94938069 missense unknown
R4839:Col1a1 UTSW 11 94950095 critical splice acceptor site probably null
R4936:Col1a1 UTSW 11 94947132 missense unknown
R5081:Col1a1 UTSW 11 94951576 missense unknown
R5105:Col1a1 UTSW 11 94942385 missense unknown
R5247:Col1a1 UTSW 11 94947187 splice site probably null
R5773:Col1a1 UTSW 11 94939429 missense probably benign 0.10
R5776:Col1a1 UTSW 11 94949724 missense unknown
R5991:Col1a1 UTSW 11 94937919 missense unknown
R6415:Col1a1 UTSW 11 94940160 missense unknown
R6483:Col1a1 UTSW 11 94942618 splice site probably null
R7207:Col1a1 UTSW 11 94938526 missense unknown
R7853:Col1a1 UTSW 11 94947679 missense unknown
R7936:Col1a1 UTSW 11 94947679 missense unknown
RF007:Col1a1 UTSW 11 94943040 missense probably damaging 1.00
Z1177:Col1a1 UTSW 11 94943804 missense not run
Predicted Primers PCR Primer
(F):5'- GCACTGCTGTAAGTACTCCTG -3'
(R):5'- GCCCATTGCCTATGACAATCATG -3'

Sequencing Primer
(F):5'- GCTGTAAGTACTCCTGCCCCC -3'
(R):5'- TGTTCAAAGAAAGAACGTGCCTC -3'
Posted On2016-06-15