Incidental Mutation 'R5110:Golga5'
ID393814
Institutional Source Beutler Lab
Gene Symbol Golga5
Ensembl Gene ENSMUSG00000021192
Gene Namegolgi autoantigen, golgin subfamily a, 5
SynonymsRet-II
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102469135-102497907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102472077 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 17 (R17Q)
Ref Sequence ENSEMBL: ENSMUSP00000137305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021609] [ENSMUST00000179218]
Predicted Effect probably benign
Transcript: ENSMUST00000021609
AA Change: R17Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021609
Gene: ENSMUSG00000021192
AA Change: R17Q

DomainStartEndE-ValueType
low complexity region 148 167 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
Pfam:Golgin_A5 233 709 1.1e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179218
AA Change: R17Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137305
Gene: ENSMUSG00000021192
AA Change: R17Q

DomainStartEndE-ValueType
low complexity region 148 167 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
Pfam:Golgin_A5 233 709 1.1e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222873
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein is a coiled-coil membrane protein that has been postulated to play a role in vesicle tethering and docking. Translocations involving this gene and the ret proto-oncogene have been found in tumor tissues; the chimeric sequences have been designated RET-II and PTC5. A pseudogene of this gene is located on the short arm of chromosome 5. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout does not result in an obvious phenotype and does not affect Golgi apparatus morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Golga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Golga5 APN 12 102493814 missense probably damaging 0.99
IGL01487:Golga5 APN 12 102495696 intron probably benign
IGL01585:Golga5 APN 12 102479695 missense probably benign
IGL01901:Golga5 APN 12 102479802 critical splice donor site probably null
IGL02063:Golga5 APN 12 102472159 missense probably benign 0.00
IGL02118:Golga5 APN 12 102495752 missense possibly damaging 0.67
IGL02568:Golga5 APN 12 102472079 missense probably benign 0.33
FR4976:Golga5 UTSW 12 102475660 intron probably null
R0244:Golga5 UTSW 12 102476188 missense probably benign
R0432:Golga5 UTSW 12 102476208 missense possibly damaging 0.50
R0552:Golga5 UTSW 12 102484493 missense possibly damaging 0.75
R0659:Golga5 UTSW 12 102476208 missense possibly damaging 0.50
R1244:Golga5 UTSW 12 102472295 missense probably benign 0.01
R1542:Golga5 UTSW 12 102474720 missense probably damaging 1.00
R1791:Golga5 UTSW 12 102492131 missense possibly damaging 0.48
R2310:Golga5 UTSW 12 102492161 missense probably damaging 0.99
R5704:Golga5 UTSW 12 102489448 missense probably benign 0.00
R6228:Golga5 UTSW 12 102484481 missense probably benign 0.00
R6229:Golga5 UTSW 12 102484481 missense probably benign 0.00
R6241:Golga5 UTSW 12 102472473 missense probably damaging 0.96
R7236:Golga5 UTSW 12 102474775 critical splice donor site probably null
R7355:Golga5 UTSW 12 102472235 missense possibly damaging 0.83
R7404:Golga5 UTSW 12 102484519 missense probably damaging 0.97
R7493:Golga5 UTSW 12 102484576 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGAGTAGTCGGGTGCTCTTACC -3'
(R):5'- CGACTTTCACGTTCGCTGTG -3'

Sequencing Primer
(F):5'- GGTGCTCTTACCCACTGAG -3'
(R):5'- CCAGCTAGGATCGTGGCTTTC -3'
Posted On2016-06-15