Incidental Mutation 'R5110:Syne3'
ID393815
Institutional Source Beutler Lab
Gene Symbol Syne3
Ensembl Gene ENSMUSG00000054150
Gene Namespectrin repeat containing, nuclear envelope family member 3
Synonyms4831426I19Rik, nesprin-3, nesprin-3alpha, nesprin-3beta
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5110 (G1)
Quality Score204
Status Validated
Chromosome12
Chromosomal Location104929933-105009809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104943370 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 736 (R736C)
Ref Sequence ENSEMBL: ENSMUSP00000105553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067005] [ENSMUST00000095439] [ENSMUST00000109927]
Predicted Effect probably benign
Transcript: ENSMUST00000067005
AA Change: R736C

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000065771
Gene: ENSMUSG00000054150
AA Change: R736C

DomainStartEndE-ValueType
Blast:SPEC 29 127 8e-24 BLAST
SPEC 136 237 1.01e-1 SMART
Blast:SPEC 252 446 9e-55 BLAST
low complexity region 447 459 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
SPEC 563 664 1.74e-1 SMART
Blast:SPEC 722 818 1e-12 BLAST
KASH 832 888 7.52e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095439
AA Change: R823C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000093090
Gene: ENSMUSG00000054150
AA Change: R823C

DomainStartEndE-ValueType
SPEC 7 109 1.22e-1 SMART
SPEC 223 324 1.01e-1 SMART
Blast:SPEC 339 533 2e-54 BLAST
low complexity region 534 546 N/A INTRINSIC
low complexity region 582 601 N/A INTRINSIC
SPEC 650 751 1.74e-1 SMART
Blast:SPEC 809 905 1e-12 BLAST
KASH 919 975 7.52e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109927
AA Change: R736C

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105553
Gene: ENSMUSG00000054150
AA Change: R736C

DomainStartEndE-ValueType
Blast:SPEC 29 127 8e-24 BLAST
SPEC 136 237 1.01e-1 SMART
Blast:SPEC 252 446 9e-55 BLAST
low complexity region 447 459 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
SPEC 563 664 1.74e-1 SMART
Blast:SPEC 722 818 1e-12 BLAST
KASH 832 888 7.52e-24 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Syne3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Syne3 APN 12 104958069 missense probably benign 0.00
IGL01986:Syne3 APN 12 104968000 missense probably damaging 1.00
IGL02303:Syne3 APN 12 104963294 missense probably damaging 1.00
IGL02469:Syne3 APN 12 104954306 missense probably benign 0.08
IGL03127:Syne3 APN 12 104943428 missense probably benign 0.02
PIT4791001:Syne3 UTSW 12 104963179 missense probably benign
R0436:Syne3 UTSW 12 104946924 missense possibly damaging 0.95
R0471:Syne3 UTSW 12 104943426 missense probably benign 0.00
R0613:Syne3 UTSW 12 104958112 missense probably benign
R0662:Syne3 UTSW 12 104961510 missense probably benign 0.44
R0707:Syne3 UTSW 12 104969360 missense probably damaging 0.98
R1321:Syne3 UTSW 12 104975796 missense probably benign 0.14
R1494:Syne3 UTSW 12 104955582 missense possibly damaging 0.87
R2035:Syne3 UTSW 12 104958127 missense probably benign 0.00
R2147:Syne3 UTSW 12 104953098 missense probably damaging 1.00
R2326:Syne3 UTSW 12 104969234 missense probably damaging 1.00
R2923:Syne3 UTSW 12 104968084 missense probably damaging 1.00
R3710:Syne3 UTSW 12 104943438 missense possibly damaging 0.86
R3946:Syne3 UTSW 12 104958066 missense probably damaging 1.00
R4542:Syne3 UTSW 12 104969244 missense probably benign 0.00
R4544:Syne3 UTSW 12 104959469 missense probably damaging 1.00
R5256:Syne3 UTSW 12 104975880 start codon destroyed probably null 1.00
R5490:Syne3 UTSW 12 104955672 missense probably damaging 1.00
R5616:Syne3 UTSW 12 104955678 missense probably damaging 1.00
R5730:Syne3 UTSW 12 104961454 missense probably benign 0.02
R5941:Syne3 UTSW 12 104946992 missense probably benign
R6208:Syne3 UTSW 12 104943363 missense probably benign 0.12
R6456:Syne3 UTSW 12 104940704 missense possibly damaging 0.87
R6566:Syne3 UTSW 12 104946707 missense probably benign 0.00
R6957:Syne3 UTSW 12 104954302 missense probably damaging 1.00
R7251:Syne3 UTSW 12 104961571 frame shift probably null
R7388:Syne3 UTSW 12 104967908 missense probably damaging 1.00
R7591:Syne3 UTSW 12 104940604 critical splice donor site probably null
R7614:Syne3 UTSW 12 104946642 missense not run
R7740:Syne3 UTSW 12 104954287 missense probably benign 0.01
R7763:Syne3 UTSW 12 104997495 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTACCTGCAGATGGAGACTTG -3'
(R):5'- AATGTGGATGACTAGAGACTGCTC -3'

Sequencing Primer
(F):5'- CTGCAGATGGAGACTTGACCTG -3'
(R):5'- GAGACTGCTCTTCGTCCCTCTG -3'
Posted On2016-06-15