Incidental Mutation 'R5110:Vmn1r194'
ID393816
Institutional Source Beutler Lab
Gene Symbol Vmn1r194
Ensembl Gene ENSMUSG00000069297
Gene Namevomeronasal 1 receptor 194
SynonymsGm11294
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22244215-22245105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 22245000 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 262 (S262R)
Ref Sequence ENSEMBL: ENSMUSP00000089331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091737]
Predicted Effect probably benign
Transcript: ENSMUST00000091737
AA Change: S262R

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089331
Gene: ENSMUSG00000069297
AA Change: S262R

DomainStartEndE-ValueType
Pfam:V1R 35 296 3.4e-37 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Vmn1r194
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Vmn1r194 APN 13 22244606 missense probably benign 0.01
IGL02140:Vmn1r194 APN 13 22244536 missense probably benign 0.08
R0066:Vmn1r194 UTSW 13 22244471 missense probably benign 0.33
R0066:Vmn1r194 UTSW 13 22244471 missense probably benign 0.33
R0109:Vmn1r194 UTSW 13 22245047 missense probably damaging 1.00
R0109:Vmn1r194 UTSW 13 22245047 missense probably damaging 1.00
R1276:Vmn1r194 UTSW 13 22244861 missense probably damaging 1.00
R1426:Vmn1r194 UTSW 13 22245066 missense probably damaging 0.99
R1620:Vmn1r194 UTSW 13 22244963 missense probably damaging 1.00
R4593:Vmn1r194 UTSW 13 22244291 missense possibly damaging 0.60
R4844:Vmn1r194 UTSW 13 22245053 missense probably benign 0.02
R5011:Vmn1r194 UTSW 13 22244888 missense probably benign 0.00
R5588:Vmn1r194 UTSW 13 22244342 missense possibly damaging 0.75
R5810:Vmn1r194 UTSW 13 22244427 nonsense probably null
R6648:Vmn1r194 UTSW 13 22244524 missense probably benign 0.11
R7660:Vmn1r194 UTSW 13 22244597 missense not run
R7663:Vmn1r194 UTSW 13 22244741 missense not run
R7879:Vmn1r194 UTSW 13 22244602 missense probably benign 0.06
R7962:Vmn1r194 UTSW 13 22244602 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCTGTATAAGCATCACAAGCG -3'
(R):5'- GGCATCTAGGACAGCTGATG -3'

Sequencing Primer
(F):5'- TGTATAAGCATCACAAGCGTGTCC -3'
(R):5'- CATCTAGGACAGCTGATGATAGC -3'
Posted On2016-06-15