Incidental Mutation 'R5110:Olfr722'
ID393818
Institutional Source Beutler Lab
Gene Symbol Olfr722
Ensembl Gene ENSMUSG00000048933
Gene Nameolfactory receptor 722
SynonymsGA_x6K02T2PMLR-5566715-5565789, MOR241-3
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49894258-49901999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 49895575 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 76 (I76L)
Ref Sequence ENSEMBL: ENSMUSP00000059721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053290]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053290
AA Change: I76L

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059721
Gene: ENSMUSG00000048933
AA Change: I76L

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 4.3e-44 PFAM
Pfam:7tm_1 41 288 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213271
Meta Mutation Damage Score 0.0877 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Olfr722
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1229:Olfr722 UTSW 14 49895254 nonsense probably null
R1400:Olfr722 UTSW 14 49895691 missense possibly damaging 0.49
R1417:Olfr722 UTSW 14 49895563 nonsense probably null
R2126:Olfr722 UTSW 14 49895067 missense probably benign 0.01
R3968:Olfr722 UTSW 14 49895526 missense probably damaging 1.00
R4008:Olfr722 UTSW 14 49895007 missense probably benign 0.00
R4032:Olfr722 UTSW 14 49894976 missense probably benign 0.22
R4409:Olfr722 UTSW 14 49895773 missense probably benign 0.01
R4934:Olfr722 UTSW 14 49895749 missense probably benign 0.00
R5232:Olfr722 UTSW 14 49895698 missense probably damaging 1.00
R7019:Olfr722 UTSW 14 49895667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATCCAGCTGGTTTGGCCC -3'
(R):5'- TCAAGAAGCTCAACTCCTGG -3'

Sequencing Primer
(F):5'- GCATAACAGACTCTAGGGTTCATG -3'
(R):5'- AAGAAGCTCAACTCCTGGTCTTCG -3'
Posted On2016-06-15