Incidental Mutation 'R0446:Or8b53'
ID 39384
Institutional Source Beutler Lab
Gene Symbol Or8b53
Ensembl Gene ENSMUSG00000061039
Gene Name olfactory receptor family 8 subfamily B member 53
Synonyms MOR165-6, GA_x6K02T2PVTD-32458442-32459374, Olfr920
MMRRC Submission 038647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R0446 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38664092-38668159 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 38667114 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 43 (L43F)
Ref Sequence ENSEMBL: ENSMUSP00000074300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074740]
AlphaFold E9Q413
Predicted Effect probably damaging
Transcript: ENSMUST00000074740
AA Change: L43F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074300
Gene: ENSMUSG00000061039
AA Change: L43F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-47 PFAM
Pfam:7tm_1 41 290 3.6e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,971,766 (GRCm39) T42A probably benign Het
Actr3b T A 5: 26,036,730 (GRCm39) I181K probably damaging Het
Avl9 G T 6: 56,713,468 (GRCm39) R242L probably benign Het
B3galt4 T C 17: 34,169,992 (GRCm39) E82G probably benign Het
Bag1 G A 4: 40,936,609 (GRCm39) T349I probably benign Het
Brip1 A T 11: 86,048,427 (GRCm39) L305Q probably damaging Het
Cdipt A G 7: 126,577,436 (GRCm39) T61A probably damaging Het
Cmya5 T A 13: 93,230,164 (GRCm39) R1641S probably benign Het
Cog7 T C 7: 121,536,295 (GRCm39) D515G probably benign Het
Cpsf4 T A 5: 145,114,054 (GRCm39) L171Q probably damaging Het
Cstpp1 G A 2: 91,135,109 (GRCm39) T20I possibly damaging Het
Cuzd1 A T 7: 130,918,009 (GRCm39) probably null Het
Dapk1 T A 13: 60,873,101 (GRCm39) probably null Het
Diaph1 A G 18: 37,986,643 (GRCm39) V1114A possibly damaging Het
Emx2 A T 19: 59,452,348 (GRCm39) K211* probably null Het
Fam170a T A 18: 50,413,699 (GRCm39) C55S possibly damaging Het
Fbxw26 A G 9: 109,572,788 (GRCm39) S119P probably benign Het
Fhip2a G A 19: 57,369,839 (GRCm39) D461N probably benign Het
Fryl G A 5: 73,254,760 (GRCm39) T894M possibly damaging Het
Gad1-ps C A 10: 99,281,383 (GRCm39) noncoding transcript Het
Gss T C 2: 155,409,665 (GRCm39) E257G probably benign Het
Klhdc1 A C 12: 69,330,082 (GRCm39) S404R probably benign Het
Kmt2e T A 5: 23,702,532 (GRCm39) probably null Het
Krt20 G A 11: 99,328,602 (GRCm39) Q108* probably null Het
Lmnb1 T A 18: 56,876,331 (GRCm39) S480T probably benign Het
Lyst T A 13: 13,812,633 (GRCm39) M1015K probably benign Het
Mdm1 T G 10: 117,987,961 (GRCm39) S290A probably benign Het
Mkln1 T A 6: 31,426,439 (GRCm39) F238I probably damaging Het
Mrgprb3 A G 7: 48,292,984 (GRCm39) V189A probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neurod6 C T 6: 55,656,614 (GRCm39) E8K probably benign Het
Nlrp12 T C 7: 3,282,659 (GRCm39) I747V probably benign Het
Notch4 C T 17: 34,784,337 (GRCm39) R43W possibly damaging Het
Obscn A T 11: 58,886,238 (GRCm39) probably benign Het
Or10d3 A T 9: 39,461,747 (GRCm39) I140N probably damaging Het
Or5p57 A T 7: 107,665,932 (GRCm39) Y24* probably null Het
Or5w20 T C 2: 87,727,199 (GRCm39) Y219H possibly damaging Het
Or6ae1 A T 7: 139,742,384 (GRCm39) S160T probably damaging Het
Or6z5 T C 7: 6,478,024 (GRCm39) V305A probably benign Het
Orc5 C T 5: 22,751,455 (GRCm39) V85I probably benign Het
Pccb T C 9: 100,864,850 (GRCm39) D468G probably damaging Het
Pdzd2 A T 15: 12,375,110 (GRCm39) V1675E probably benign Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Pltp A T 2: 164,696,320 (GRCm39) N97K probably damaging Het
Polr1a T C 6: 71,927,648 (GRCm39) probably null Het
Prss42 G A 9: 110,628,341 (GRCm39) V162I possibly damaging Het
Rbfox2 A T 15: 76,983,455 (GRCm39) Y269N probably damaging Het
Rftn2 A T 1: 55,253,354 (GRCm39) I83K probably damaging Het
S1pr4 A T 10: 81,334,823 (GRCm39) I217N probably damaging Het
Slc23a2 T C 2: 131,920,353 (GRCm39) K184R probably benign Het
Slc6a19 T C 13: 73,839,814 (GRCm39) N156S probably benign Het
Svep1 C T 4: 58,088,280 (GRCm39) G1723D probably damaging Het
Tbc1d32 T A 10: 56,068,994 (GRCm39) H358L possibly damaging Het
Tex55 G A 16: 38,649,064 (GRCm39) T15I probably benign Het
Tigit G T 16: 43,482,634 (GRCm39) N33K probably damaging Het
Tmem25 T C 9: 44,707,878 (GRCm39) Y139C probably damaging Het
Trmt13 G A 3: 116,376,275 (GRCm39) T372M probably damaging Het
Ubr2 A T 17: 47,294,224 (GRCm39) M303K probably damaging Het
Usp34 A G 11: 23,417,207 (GRCm39) E2952G probably damaging Het
Zan T A 5: 137,389,920 (GRCm39) I4851F unknown Het
Zfand4 C T 6: 116,265,015 (GRCm39) T160I probably benign Het
Zfp1005 A G 2: 150,109,993 (GRCm39) T228A possibly damaging Het
Other mutations in Or8b53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Or8b53 APN 9 38,667,550 (GRCm39) missense probably damaging 1.00
IGL01728:Or8b53 APN 9 38,667,391 (GRCm39) missense possibly damaging 0.63
IGL01867:Or8b53 APN 9 38,667,194 (GRCm39) missense probably damaging 1.00
IGL02271:Or8b53 APN 9 38,667,784 (GRCm39) missense probably benign
IGL03078:Or8b53 APN 9 38,667,541 (GRCm39) nonsense probably null
R0166:Or8b53 UTSW 9 38,667,484 (GRCm39) missense probably benign
R0453:Or8b53 UTSW 9 38,667,425 (GRCm39) missense probably damaging 0.99
R0556:Or8b53 UTSW 9 38,667,041 (GRCm39) missense possibly damaging 0.88
R1585:Or8b53 UTSW 9 38,667,716 (GRCm39) missense probably damaging 1.00
R2847:Or8b53 UTSW 9 38,667,332 (GRCm39) missense possibly damaging 0.89
R4676:Or8b53 UTSW 9 38,666,955 (GRCm39) start gained probably benign
R4825:Or8b53 UTSW 9 38,667,703 (GRCm39) missense probably damaging 1.00
R5026:Or8b53 UTSW 9 38,667,041 (GRCm39) missense probably benign 0.01
R5144:Or8b53 UTSW 9 38,667,689 (GRCm39) missense possibly damaging 0.90
R5573:Or8b53 UTSW 9 38,667,000 (GRCm39) missense probably damaging 1.00
R5872:Or8b53 UTSW 9 38,667,412 (GRCm39) missense probably benign 0.06
R6131:Or8b53 UTSW 9 38,667,362 (GRCm39) missense probably damaging 1.00
R6729:Or8b53 UTSW 9 38,667,124 (GRCm39) missense probably benign 0.00
R7731:Or8b53 UTSW 9 38,667,542 (GRCm39) missense possibly damaging 0.90
R7800:Or8b53 UTSW 9 38,667,914 (GRCm39) missense probably damaging 0.97
R8960:Or8b53 UTSW 9 38,667,385 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGACAGCCCCACTCTCAGGATTAG -3'
(R):5'- CATCCAGTGTGGATCATAGCACCAG -3'

Sequencing Primer
(F):5'- AGATCTTCATGATCCTTTAATTCACC -3'
(R):5'- TGGATTGCAGATAGCCACATAAC -3'
Posted On 2013-05-23