Incidental Mutation 'R5111:Myt1'
ID393844
Institutional Source Beutler Lab
Gene Symbol Myt1
Ensembl Gene ENSMUSG00000010505
Gene Namemyelin transcription factor 1
SynonymsNZF-2a, NZF-2b, Nzf2, Nztf2
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5111 (G1)
Quality Score223
Status Validated
Chromosome2
Chromosomal Location181763332-181827797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181795885 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 172 (T172A)
Ref Sequence ENSEMBL: ENSMUSP00000079900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081125] [ENSMUST00000108756] [ENSMUST00000108757] [ENSMUST00000183403]
Predicted Effect probably benign
Transcript: ENSMUST00000081125
AA Change: T172A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000079900
Gene: ENSMUSG00000010505
AA Change: T172A

DomainStartEndE-ValueType
Pfam:zf-C2HC 71 99 8.7e-16 PFAM
low complexity region 155 160 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
coiled coil region 300 354 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Pfam:zf-C2HC 485 512 2.9e-14 PFAM
Pfam:zf-C2HC 529 557 4.3e-16 PFAM
Pfam:MYT1 604 660 2e-28 PFAM
Pfam:MYT1 659 835 2.3e-56 PFAM
Pfam:zf-C2HC 843 871 2e-18 PFAM
Pfam:zf-C2HC 887 915 1.9e-18 PFAM
Pfam:zf-C2HC 936 964 2.1e-16 PFAM
Pfam:zf-C2HC 989 1017 8.4e-16 PFAM
coiled coil region 1037 1109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108756
AA Change: T130A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104387
Gene: ENSMUSG00000010505
AA Change: T130A

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 5.1e-18 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 5e-17 PFAM
Pfam:zf-C2HC 485 515 3.1e-18 PFAM
Pfam:MYT1 562 618 2.4e-32 PFAM
Pfam:MYT1 617 794 2e-74 PFAM
Pfam:zf-C2HC 799 829 1.9e-19 PFAM
Pfam:zf-C2HC 843 873 9.7e-20 PFAM
Pfam:zf-C2HC 892 922 2.2e-18 PFAM
Pfam:zf-C2HC 945 975 1.7e-16 PFAM
coiled coil region 995 1067 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108757
AA Change: T130A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104388
Gene: ENSMUSG00000010505
AA Change: T130A

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 1e-17 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 1e-16 PFAM
Pfam:zf-C2HC 485 510 6.2e-12 PFAM
Pfam:MYT1 524 580 2.7e-32 PFAM
Pfam:MYT1 579 756 2.3e-74 PFAM
Pfam:zf-C2HC 761 791 3.8e-19 PFAM
Pfam:zf-C2HC 805 835 1.9e-19 PFAM
Pfam:zf-C2HC 854 884 4.3e-18 PFAM
Pfam:zf-C2HC 907 937 3.3e-16 PFAM
coiled coil region 957 1029 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129843
SMART Domains Protein: ENSMUSP00000115697
Gene: ENSMUSG00000010505

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:zf-C2HC 147 174 6.2e-15 PFAM
Pfam:zf-C2HC 191 219 9.2e-17 PFAM
Pfam:MYT1 266 322 7.3e-29 PFAM
Pfam:MYT1 321 497 7.2e-57 PFAM
Pfam:zf-C2HC 505 533 9.6e-19 PFAM
Pfam:zf-C2HC 554 582 4.4e-17 PFAM
Pfam:zf-C2HC 607 635 1.8e-16 PFAM
coiled coil region 654 726 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000129856
AA Change: T163A
SMART Domains Protein: ENSMUSP00000122011
Gene: ENSMUSG00000010505
AA Change: T163A

DomainStartEndE-ValueType
Pfam:zf-C2HC 63 91 1.4e-16 PFAM
low complexity region 147 152 N/A INTRINSIC
Pfam:zf-C2HC 177 204 4.6e-15 PFAM
Pfam:zf-C2HC 221 249 6.7e-17 PFAM
Pfam:MYT1 296 352 5.2e-29 PFAM
Pfam:MYT1 351 527 4.5e-57 PFAM
Pfam:zf-C2HC 535 556 1.4e-13 PFAM
Pfam:zf-C2HC 556 584 3.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156190
Predicted Effect probably benign
Transcript: ENSMUST00000183403
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene is a member of the myelin transcription factor 1 gene family. The encoded protein, a zinc finger DNA-binding protein, is involved in regulation of oligodendrocyte differentiation and proliferation in the developing central nervous system. The gene product has a role in remyelination through regeneration of oligodendrocyte lineage cells in response to demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth displaying improper diaphragm innervation and a failture to initiate breathing; mutant embryonic pancreata contain abnormal islet cells that express multiple hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Myt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Myt1 APN 2 181801115 missense probably damaging 1.00
IGL00816:Myt1 APN 2 181807515 missense probably damaging 0.97
IGL01062:Myt1 APN 2 181797729 missense probably damaging 1.00
IGL01069:Myt1 APN 2 181825956 missense probably damaging 1.00
IGL01292:Myt1 APN 2 181805012 missense probably damaging 1.00
IGL01521:Myt1 APN 2 181825911 missense probably damaging 1.00
IGL01926:Myt1 APN 2 181821997 missense probably benign 0.00
IGL01976:Myt1 APN 2 181795739 missense probably damaging 1.00
IGL02066:Myt1 APN 2 181797189 missense probably damaging 1.00
IGL02109:Myt1 APN 2 181815617 splice site probably benign
IGL02209:Myt1 APN 2 181797234 missense probably benign 0.06
IGL02499:Myt1 APN 2 181825549 splice site probably benign
IGL03064:Myt1 APN 2 181797801 missense probably benign 0.31
IGL03394:Myt1 APN 2 181797845 missense probably damaging 1.00
PIT4366001:Myt1 UTSW 2 181825938 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0362:Myt1 UTSW 2 181763393 unclassified probably benign
R0627:Myt1 UTSW 2 181795689 missense probably benign 0.10
R0650:Myt1 UTSW 2 181782615 nonsense probably null
R0735:Myt1 UTSW 2 181807387 unclassified probably benign
R0744:Myt1 UTSW 2 181797505 intron probably benign
R1115:Myt1 UTSW 2 181811231 nonsense probably null
R1460:Myt1 UTSW 2 181802932 missense probably damaging 1.00
R1471:Myt1 UTSW 2 181797111 missense probably benign
R1836:Myt1 UTSW 2 181797275 missense probably benign
R1905:Myt1 UTSW 2 181797756 missense probably damaging 1.00
R2007:Myt1 UTSW 2 181795759 missense probably benign
R2040:Myt1 UTSW 2 181825924 missense probably damaging 1.00
R2140:Myt1 UTSW 2 181825979 missense probably damaging 1.00
R2323:Myt1 UTSW 2 181806557 missense probably damaging 1.00
R2926:Myt1 UTSW 2 181826010 missense possibly damaging 0.93
R3895:Myt1 UTSW 2 181820070 missense probably damaging 1.00
R4093:Myt1 UTSW 2 181811398 missense probably damaging 1.00
R4649:Myt1 UTSW 2 181797414 missense probably benign
R4693:Myt1 UTSW 2 181795739 missense probably damaging 1.00
R4775:Myt1 UTSW 2 181822677 missense probably damaging 1.00
R4835:Myt1 UTSW 2 181797462 missense probably damaging 0.99
R5120:Myt1 UTSW 2 181797620 missense probably benign 0.25
R5622:Myt1 UTSW 2 181797122 missense probably benign
R6457:Myt1 UTSW 2 181763425 splice site probably null
R6704:Myt1 UTSW 2 181811212 start codon destroyed probably null
R6752:Myt1 UTSW 2 181801082 missense probably damaging 1.00
R6944:Myt1 UTSW 2 181797594 missense possibly damaging 0.52
R7337:Myt1 UTSW 2 181802963 missense possibly damaging 0.71
R7362:Myt1 UTSW 2 181797240 missense probably benign 0.00
R7368:Myt1 UTSW 2 181782591 missense possibly damaging 0.53
R7385:Myt1 UTSW 2 181767705 splice site probably null
R7411:Myt1 UTSW 2 181815106 missense probably damaging 1.00
R7593:Myt1 UTSW 2 181797739 missense possibly damaging 0.54
R7790:Myt1 UTSW 2 181797597 missense probably benign 0.00
R8035:Myt1 UTSW 2 181795739 missense probably damaging 1.00
R8156:Myt1 UTSW 2 181822761 critical splice donor site probably null
R8338:Myt1 UTSW 2 181801862 missense possibly damaging 0.94
R8419:Myt1 UTSW 2 181782606 nonsense probably null
RF006:Myt1 UTSW 2 181797773 missense probably damaging 1.00
Z1177:Myt1 UTSW 2 181797162 missense probably damaging 0.97
Z1177:Myt1 UTSW 2 181807602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAGGAAGTCACACCCTCTG -3'
(R):5'- TACCCTGCACACAGTGTTC -3'

Sequencing Primer
(F):5'- AAGTCACACCCTCTGAGGCTG -3'
(R):5'- TGTTCACACACTCTATAGTAGCAC -3'
Posted On2016-06-15