Incidental Mutation 'R5111:Bcan'
ID393845
Institutional Source Beutler Lab
Gene Symbol Bcan
Ensembl Gene ENSMUSG00000004892
Gene Namebrevican
SynonymsCspg7
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5111 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87987531-88000230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87994207 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 396 (S396Y)
Ref Sequence ENSEMBL: ENSMUSP00000088491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090971] [ENSMUST00000194193]
Predicted Effect probably damaging
Transcript: ENSMUST00000090971
AA Change: S396Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088491
Gene: ENSMUSG00000004892
AA Change: S396Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGv 51 138 5.74e-13 SMART
LINK 154 251 9.37e-55 SMART
LINK 255 353 2.67e-59 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
EGF 625 658 1.07e-5 SMART
CLECT 664 785 1.15e-33 SMART
CCP 791 847 2.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193276
Predicted Effect probably benign
Transcript: ENSMUST00000194193
SMART Domains Protein: ENSMUSP00000141455
Gene: ENSMUSG00000004892

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IGv 51 105 1e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194596
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired LTP maintenance, but mutant animals show normal behavior and spatial learning capabilities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Bcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Bcan APN 3 87994174 missense probably damaging 1.00
IGL00981:Bcan APN 3 87997832 missense possibly damaging 0.66
IGL02355:Bcan APN 3 87994142 missense possibly damaging 0.65
IGL02362:Bcan APN 3 87994142 missense possibly damaging 0.65
IGL03190:Bcan APN 3 87993050 unclassified probably benign
R0392:Bcan UTSW 3 87993562 nonsense probably null
R0938:Bcan UTSW 3 87993154 missense possibly damaging 0.96
R1118:Bcan UTSW 3 87989227 missense probably damaging 1.00
R1559:Bcan UTSW 3 87994212 missense probably damaging 0.96
R1653:Bcan UTSW 3 87994196 missense probably damaging 0.99
R1699:Bcan UTSW 3 87989236 missense probably damaging 1.00
R1762:Bcan UTSW 3 87993625 missense probably benign 0.00
R1802:Bcan UTSW 3 87993108 missense possibly damaging 0.58
R1870:Bcan UTSW 3 87995601 missense probably damaging 1.00
R1929:Bcan UTSW 3 87993094 missense probably damaging 1.00
R2172:Bcan UTSW 3 87996581 missense probably damaging 1.00
R2271:Bcan UTSW 3 87993094 missense probably damaging 1.00
R4036:Bcan UTSW 3 87996116 critical splice donor site probably null
R4363:Bcan UTSW 3 87997098 missense probably damaging 1.00
R4491:Bcan UTSW 3 87990233 nonsense probably null
R5122:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5167:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5234:Bcan UTSW 3 87996146 missense probably damaging 1.00
R5363:Bcan UTSW 3 87995487 missense probably damaging 1.00
R5365:Bcan UTSW 3 87989235 missense probably damaging 1.00
R5544:Bcan UTSW 3 87993053 critical splice donor site probably null
R5663:Bcan UTSW 3 87995613 missense probably damaging 0.98
R6044:Bcan UTSW 3 87995643 missense probably damaging 1.00
R6495:Bcan UTSW 3 87996597 missense possibly damaging 0.91
R6725:Bcan UTSW 3 87995484 missense possibly damaging 0.69
R6764:Bcan UTSW 3 87988378 missense probably damaging 1.00
R7000:Bcan UTSW 3 87988379 nonsense probably null
R7294:Bcan UTSW 3 87995524 missense possibly damaging 0.51
R7338:Bcan UTSW 3 87994243 missense probably damaging 1.00
R7942:Bcan UTSW 3 87993075 missense probably benign 0.40
R8428:Bcan UTSW 3 87997098 missense probably damaging 1.00
X0013:Bcan UTSW 3 87996159 missense possibly damaging 0.69
Z1176:Bcan UTSW 3 87990750 missense probably damaging 1.00
Z1176:Bcan UTSW 3 87990755 missense probably damaging 1.00
Z1176:Bcan UTSW 3 87995650 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGTGACCACTTGGGCTTGC -3'
(R):5'- ACATTCCAGGGCCTGTAGAG -3'

Sequencing Primer
(F):5'- ACTTGGGCTTGCCCTCCTAC -3'
(R):5'- CACCCTGGGAGGATTCAAATGC -3'
Posted On2016-06-15