Incidental Mutation 'R5111:Vmn2r18'
ID393852
Institutional Source Beutler Lab
Gene Symbol Vmn2r18
Ensembl Gene ENSMUSG00000091794
Gene Namevomeronasal 2, receptor 18
SynonymsEG632671
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5111 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location151561661-151586906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151562448 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 527 (M527K)
Ref Sequence ENSEMBL: ENSMUSP00000127506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165928]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165928
AA Change: M527K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127506
Gene: ENSMUSG00000091794
AA Change: M527K

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 403 5.7e-39 PFAM
Pfam:NCD3G 446 499 5.5e-20 PFAM
Pfam:7tm_3 531 767 5e-53 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Vmn2r18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Vmn2r18 APN 5 151572831 missense probably damaging 0.99
IGL01564:Vmn2r18 APN 5 151585168 missense possibly damaging 0.69
IGL01602:Vmn2r18 APN 5 151586641 missense possibly damaging 0.64
IGL01605:Vmn2r18 APN 5 151586641 missense possibly damaging 0.64
IGL01619:Vmn2r18 APN 5 151586764 missense probably benign 0.25
IGL02177:Vmn2r18 APN 5 151586809 missense possibly damaging 0.76
IGL02682:Vmn2r18 APN 5 151584637 missense probably damaging 0.99
IGL02751:Vmn2r18 APN 5 151584607 missense probably benign 0.09
IGL02977:Vmn2r18 APN 5 151586684 missense probably damaging 1.00
R0089:Vmn2r18 UTSW 5 151584804 missense probably benign 0.00
R0282:Vmn2r18 UTSW 5 151585203 missense probably benign 0.02
R0529:Vmn2r18 UTSW 5 151562523 missense probably damaging 0.99
R0812:Vmn2r18 UTSW 5 151572930 splice site probably benign
R1467:Vmn2r18 UTSW 5 151586836 missense possibly damaging 0.48
R1467:Vmn2r18 UTSW 5 151586836 missense possibly damaging 0.48
R1506:Vmn2r18 UTSW 5 151575634 splice site probably null
R1562:Vmn2r18 UTSW 5 151586836 missense probably benign 0.12
R1637:Vmn2r18 UTSW 5 151584757 missense probably damaging 1.00
R1651:Vmn2r18 UTSW 5 151561999 missense probably damaging 1.00
R1883:Vmn2r18 UTSW 5 151575725 missense probably benign 0.37
R1884:Vmn2r18 UTSW 5 151575725 missense probably benign 0.37
R1914:Vmn2r18 UTSW 5 151575821 missense probably benign 0.02
R2051:Vmn2r18 UTSW 5 151562551 missense possibly damaging 0.90
R2056:Vmn2r18 UTSW 5 151584695 missense probably damaging 0.98
R2252:Vmn2r18 UTSW 5 151584976 missense possibly damaging 0.59
R2265:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2266:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2267:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2843:Vmn2r18 UTSW 5 151562284 missense probably damaging 1.00
R3023:Vmn2r18 UTSW 5 151561683 missense probably benign 0.13
R3694:Vmn2r18 UTSW 5 151584568 missense probably benign 0.00
R3763:Vmn2r18 UTSW 5 151585179 missense probably damaging 1.00
R3816:Vmn2r18 UTSW 5 151561683 missense probably benign 0.13
R4007:Vmn2r18 UTSW 5 151585246 missense probably damaging 0.99
R4152:Vmn2r18 UTSW 5 151562265 missense probably damaging 1.00
R4308:Vmn2r18 UTSW 5 151584803 nonsense probably null
R4362:Vmn2r18 UTSW 5 151572903 missense probably damaging 1.00
R4618:Vmn2r18 UTSW 5 151584959 missense possibly damaging 0.64
R4716:Vmn2r18 UTSW 5 151562137 missense possibly damaging 0.87
R4817:Vmn2r18 UTSW 5 151585432 splice site probably null
R5692:Vmn2r18 UTSW 5 151562259 missense possibly damaging 0.65
R6115:Vmn2r18 UTSW 5 151584997 missense possibly damaging 0.81
R6244:Vmn2r18 UTSW 5 151584651 missense probably damaging 1.00
R6595:Vmn2r18 UTSW 5 151562424 missense probably damaging 1.00
R6997:Vmn2r18 UTSW 5 151561873 missense possibly damaging 0.95
R7227:Vmn2r18 UTSW 5 151572799 missense probably damaging 1.00
R7349:Vmn2r18 UTSW 5 151562217 nonsense probably null
R7506:Vmn2r18 UTSW 5 151585020 missense possibly damaging 0.51
R7590:Vmn2r18 UTSW 5 151561729 missense probably damaging 1.00
R7721:Vmn2r18 UTSW 5 151586693 missense possibly damaging 0.53
R7877:Vmn2r18 UTSW 5 151584972 missense probably damaging 1.00
R7882:Vmn2r18 UTSW 5 151561864 missense probably damaging 1.00
R7984:Vmn2r18 UTSW 5 151562061 missense probably damaging 1.00
R8295:Vmn2r18 UTSW 5 151585156 missense probably damaging 0.97
R8353:Vmn2r18 UTSW 5 151561908 missense probably damaging 1.00
R8453:Vmn2r18 UTSW 5 151561908 missense probably damaging 1.00
Z1176:Vmn2r18 UTSW 5 151585033 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCAATGTGAACACAAGTGC -3'
(R):5'- GAATGTGCCAGGCTAAACAC -3'

Sequencing Primer
(F):5'- CCAATGTGAACACAAGTGCAAATG -3'
(R):5'- TGTGCCAGGCTAAACACAACATAAG -3'
Posted On2016-06-15