Incidental Mutation 'R5111:Klrb1c'
ID393853
Institutional Source Beutler Lab
Gene Symbol Klrb1c
Ensembl Gene ENSMUSG00000030325
Gene Namekiller cell lectin-like receptor subfamily B member 1C
SynonymsNK-RP1, Nk1.1, Nk1, Ly-59, Ly59, Ly55c, CD161, Nkrp1-c, Nk-1, NKR-P1C, NK-1.1, Nk-1.2, NKR-P1
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5111 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128778485-128789215 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128786005 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 83 (R83H)
Ref Sequence ENSEMBL: ENSMUSP00000134504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167691] [ENSMUST00000174404] [ENSMUST00000174865] [ENSMUST00000204394] [ENSMUST00000204423] [ENSMUST00000204677] [ENSMUST00000204756]
Predicted Effect probably benign
Transcript: ENSMUST00000167691
AA Change: R83H

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127297
Gene: ENSMUSG00000030325
AA Change: R83H

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
CLECT 139 256 1.65e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172601
AA Change: R36H
SMART Domains Protein: ENSMUSP00000134184
Gene: ENSMUSG00000030325
AA Change: R36H

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
CLECT 90 207 1.65e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174404
AA Change: R83H

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134504
Gene: ENSMUSG00000030325
AA Change: R83H

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
CLECT 142 259 1.65e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174865
AA Change: R67H

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134055
Gene: ENSMUSG00000030325
AA Change: R67H

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204394
SMART Domains Protein: ENSMUSP00000145481
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 8.5e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204423
SMART Domains Protein: ENSMUSP00000145327
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 8.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204677
SMART Domains Protein: ENSMUSP00000145287
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
PDB:3M9Z|A 89 144 2e-30 PDB
SCOP:d1e87a_ 94 143 2e-12 SMART
Blast:CLECT 94 144 3e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204756
SMART Domains Protein: ENSMUSP00000144777
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
CLECT 85 185 1e-14 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: This locus controls an antigen on natural killer cells. The a allele determines the Nk1.1 antigen in strains CE, C57BL/6, C57BR/cd, C57L, C58, DBA/1, MA/My, NZB, SJL, SM and B10.D2. The b allele determines the Nk1.2 antigen in strains CBA/J, BALB/c, C3H/He, A/J, DBA/2, LP and 129. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Klrb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02636:Klrb1c APN 6 128788552 missense probably benign 0.01
Freakish UTSW 6 128784185 missense probably benign 0.38
Unnatural UTSW 6 128784211 missense probably benign 0.09
wacky UTSW 6 128780343 missense probably damaging 1.00
Weird UTSW 6 128784257 missense probably benign 0.00
Wild UTSW 6 128786005 missense probably benign 0.09
R0463:Klrb1c UTSW 6 128780403 missense probably benign 0.07
R3157:Klrb1c UTSW 6 128784739 missense possibly damaging 0.88
R3779:Klrb1c UTSW 6 128780343 missense probably damaging 1.00
R5149:Klrb1c UTSW 6 128783707 missense probably benign 0.07
R5196:Klrb1c UTSW 6 128780299 missense probably benign 0.00
R5568:Klrb1c UTSW 6 128788914 intron probably benign
R5620:Klrb1c UTSW 6 128784743 missense possibly damaging 0.67
R6000:Klrb1c UTSW 6 128784157 missense probably damaging 1.00
R6483:Klrb1c UTSW 6 128784185 missense probably benign 0.38
R6854:Klrb1c UTSW 6 128788418 missense possibly damaging 0.87
R7283:Klrb1c UTSW 6 128784257 missense probably benign 0.00
R7697:Klrb1c UTSW 6 128780310 missense probably benign 0.02
Z1177:Klrb1c UTSW 6 128788447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGGGTATGGGATACTGTC -3'
(R):5'- CCTGGAATTCTGCTTTAAGATGGTG -3'

Sequencing Primer
(F):5'- GTATGGGATACTGTCCTGTTCCTAC -3'
(R):5'- TGGAGAAAGGCTCATATCTGC -3'
Posted On2016-06-15